Result : EXP00362
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00362 |
| NCBI Accession ID | NC_011916.1 |
| Organism | Caulobacter vibrioides NA1000 |
| Left | 3752732 |
| Right | 3752809 |
| Strand | + |
| Nucleotide Sequence | ATGTCTTTCGCCGCGACCAAAACTATTACCCGCAAAACGACCCACCTTGGTGGGGCGGCGGGCGTGCGCGCGATCTAA |
| Sequence | MSFAATKTITRKTTHLGGAAGVRAI |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 25078267 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 25 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3752732 | 3752809 | + | NC_011916.1 | Caulobacter vibrioides NA1000 |
| 2 | 1632960 | 1633037 | - | NZ_CP026100.1 | Caulobacter flavus |
| 3 | 4627620 | 4627700 | - | NZ_CP048815.1 | Caulobacter rhizosphaerae |
| 4 | 4279135 | 4279215 | + | NZ_CP027850.1 | Caulobacter segnis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP026100.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02774.20 | 1.0 | 4 | 99.5 | same-strand | Semialdehyde dehydrogenase, dimerisation domain |
| 2 | PF01118.26 | 1.0 | 4 | 99.5 | same-strand | Semialdehyde dehydrogenase, NAD binding domain |
| 3 | PF13409.8 | 0.75 | 3 | 3114 | same-strand | Glutathione S-transferase, N-terminal domain |
| 4 | PF02798.22 | 0.75 | 3 | 3114 | same-strand | Glutathione S-transferase, N-terminal domain |
++ More..