Result : EXP00351
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00351 |
| NCBI Accession ID | NC_011916.1 |
| Organism | Caulobacter vibrioides NA1000 |
| Left | 2335874 |
| Right | 2335921 |
| Strand | + |
| Nucleotide Sequence | GTGCGCAAAACCATGATCGTACTTATGGAGCGGCCGTTCGCGGGGTGA |
| Sequence | VRKTMIVLMERPFAG |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 25078267 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 15 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2335874 | 2335921 | + | NC_011916.1 | Caulobacter vibrioides NA1000 |
| 2 | 1427575 | 1427622 | - | NZ_CP027850.1 | Caulobacter segnis |
| 3 | 1522334 | 1522381 | - | NZ_CP048815.1 | Caulobacter rhizosphaerae |
| 4 | 3043217 | 3043264 | - | NZ_CP026100.1 | Caulobacter flavus |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_011916.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01715.19 | 1.0 | 4 | 878.5 | same-strand | IPP transferase |
| 2 | PF02464.19 | 1.0 | 4 | 187.0 | same-strand | Competence-damaged protein |
| 3 | PF02776.20 | 1.0 | 4 | 107.5 | same-strand | Thiamine pyrophosphate enzyme, N-terminal TPP binding domain |
| 4 | PF02775.23 | 1.0 | 4 | 107.5 | same-strand | Thiamine pyrophosphate enzyme, C-terminal TPP binding domain |
| 5 | PF00205.24 | 1.0 | 4 | 107.5 | same-strand | Thiamine pyrophosphate enzyme, central domain |
| 6 | PF10369.11 | 1.0 | 4 | 1955.0 | same-strand | Small subunit of acetolactate synthase |
| 7 | PF01842.27 | 1.0 | 4 | 1955.0 | same-strand | ACT domain |
| 8 | PF13710.8 | 1.0 | 4 | 1955.0 | same-strand | ACT domain |
| 9 | PF13291.8 | 1.0 | 4 | 1955.0 | same-strand | ACT domain |
++ More..