Result : EXP00350
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00350 |
| NCBI Accession ID | NC_011916.1 |
| Organism | Caulobacter vibrioides NA1000 |
| Left | 2088068 |
| Right | 2088118 |
| Strand | + |
| Nucleotide Sequence | ATGATCGACGCTTTCGTCCTGGCCCGCCCCTATTACCGCCCGCTGCCATAG |
| Sequence | MIDAFVLARPYYRPLP |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 25078267 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 16 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2362796 | 2362846 | + | NZ_CP027850.1 | Caulobacter segnis |
| 2 | 2088068 | 2088118 | + | NC_011916.1 | Caulobacter vibrioides NA1000 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP027850.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02082.22 | 1.0 | 2 | 3404.0 | opposite-strand | Iron-dependent Transcriptional regulator |
| 2 | PF03702.16 | 1.0 | 2 | -1.0 | opposite-strand | Anhydro-N-acetylmuramic acid kinase |
| 3 | PF00579.27 | 1.0 | 2 | 163.5 | same-strand | tRNA synthetases class I (W and Y) |
| 4 | PF00578.23 | 1.0 | 2 | 1523.5 | same-strand | AhpC/TSA family |
| 5 | PF08534.12 | 1.0 | 2 | 1523.5 | same-strand | Redoxin |
| 6 | PF01551.24 | 1.0 | 2 | 2219.5 | same-strand | Peptidase family M23 |
| 7 | PF04519.15 | 1.0 | 2 | 3351.5 | same-strand | Polymer-forming cytoskeletal |
++ More..