Result : EXP00349
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00349 |
| NCBI Accession ID | NC_011916.1 |
| Organism | Caulobacter vibrioides NA1000 |
| Left | 1730240 |
| Right | 1730296 |
| Strand | + |
| Nucleotide Sequence | ATGACTGTCACGCGCGACCTGCTTTCGCTTCGGCTTATCAGCCCCTGGGCGCTCTAG |
| Sequence | MTVTRDLLSLRLISPWAL |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 25078267 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 18 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1730240 | 1730296 | + | NC_011916.1 | Caulobacter vibrioides NA1000 |
| 2 | 1568439 | 1568495 | + | NZ_CP027850.1 | Caulobacter segnis |
| 3 | 4371980 | 4372036 | - | NZ_CP048815.1 | Caulobacter rhizosphaerae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_011916.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF03358.17 | 1.0 | 3 | 2700 | opposite-strand | NADPH-dependent FMN reductase |
| 2 | PF09335.13 | 1.0 | 3 | 210 | same-strand | SNARE associated Golgi protein |
| 3 | PF00682.21 | 1.0 | 3 | 88 | same-strand | HMGL-like |
| 4 | PF08502.12 | 1.0 | 3 | 88 | same-strand | LeuA allosteric (dimerisation) domain |
| 5 | PF00892.22 | 1.0 | 3 | 2345 | same-strand | EamA-like transporter family |
| 6 | PF06723.15 | 1.0 | 3 | 3602 | same-strand | MreB/Mbl protein |
| 7 | PF04085.16 | 0.67 | 2 | 4404.5 | same-strand | rod shape-determining protein MreC |
++ More..