Result : EXP00326
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00326 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 3039706 |
| Right | 3039762 |
| Strand | - |
| Nucleotide Sequence | GTGACCATAAGGGGCGCAAGTGAAACAGGATCTGGCACGCATCGAGCAGTTTCTTGA |
| Sequence | VTIRGASETGSGTHRAVS |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 18 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3777982 | 3778038 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 3039706 | 3039762 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 1933431 | 1933487 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 4 | 653782 | 653838 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 2973620 | 2973676 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00152.22 | 1.0 | 4 | 4532 | same-strand | tRNA synthetases class II (D, K and N) |
| 2 | PF01336.27 | 1.0 | 4 | 4532 | same-strand | OB-fold nucleic acid binding domain |
| 3 | PF00472.22 | 1.0 | 4 | 3641 | same-strand | RF-1 domain |
| 4 | PF02272.21 | 1.0 | 4 | 1600 | same-strand | DHHA1 domain |
| 5 | PF01368.22 | 1.0 | 4 | 1600 | same-strand | DHH family |
| 6 | PF17768.3 | 1.0 | 4 | 1600 | same-strand | RecJ OB domain |
| 7 | PF13098.8 | 1.0 | 4 | 884 | same-strand | Thioredoxin-like domain |
| 8 | PF10411.11 | 1.0 | 4 | 884 | same-strand | Disulfide bond isomerase protein N-terminus |
| 9 | PF00589.24 | 1.0 | 4 | -37 | same-strand | Phage integrase family |
| 10 | PF02899.19 | 1.0 | 4 | -37 | same-strand | Phage integrase, N-terminal SAM-like domain |
| 11 | PF13495.8 | 1.0 | 4 | -37 | same-strand | Phage integrase, N-terminal SAM-like domain |
| 12 | PF00258.27 | 1.0 | 4 | 93 | opposite-strand | Flavodoxin |
| 13 | PF07254.14 | 1.0 | 4 | 654 | same-strand | Membrane-bound toxin component of toxin-antitoxin system |
| 14 | PF03937.18 | 1.0 | 4 | 1042 | same-strand | Flavinator of succinate dehydrogenase |
| 15 | PF03006.22 | 1.0 | 4 | 2617 | same-strand | Haemolysin-III related |
++ More..