Result : EXP00324
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00324 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 1642432 |
| Right | 1642488 |
| Strand | - |
| Nucleotide Sequence | ATGATTTTTGCTGAAGATGGCGACATGATGTTTGCATTTTTCAAAAAATATGGATAA |
| Sequence | MIFAEDGDMMFAFFKKYG |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 18 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1642432 | 1642488 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 3992322 | 3992378 | + | NZ_CP057657.1 | Escherichia fergusonii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF07041.13 | 1.0 | 2 | 2063.5 | same-strand | Protein of unknown function (DUF1327) |
| 2 | PF04971.14 | 1.0 | 2 | 1852.5 | same-strand | Bacteriophage P21 holin S |
| 3 | PF16080.7 | 1.0 | 2 | 1852.5 | same-strand | Bacteriophage holin family HP1 |
| 4 | PF00313.24 | 1.0 | 2 | 618.5 | both-strands | 'Cold-shock' DNA-binding domain |
| 5 | PF03589.15 | 1.0 | 2 | 1.0 | same-strand | Antitermination protein |
++ More..