Result : EXP00322
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00322 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 3339197 |
| Right | 3339238 |
| Strand | - |
| Nucleotide Sequence | ATGCGCTGGCGTCGCTCGGACATAAAGGGATTAAAACCCTGA |
| Sequence | MRWRRSDIKGLKP |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 13 |
++ More..
| Conservation Analysis |
No. of Species: 5
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4081678 | 4081719 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 3322755 | 3322796 | - | NZ_AP014857.1 | Escherichia albertii |
| 3 | 3339197 | 3339238 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 4 | 3331377 | 3331418 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 5 | 477623 | 477664 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 6 | 3844350 | 3844391 | - | NZ_LR134340.1 | Escherichia marmotae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF13466.8 | 1.0 | 5 | 1941.0 | same-strand | STAS domain |
| 2 | PF05494.14 | 1.0 | 5 | 1306.0 | same-strand | MlaC protein |
| 3 | PF02470.22 | 1.0 | 5 | 736.0 | same-strand | MlaD protein |
| 4 | PF02405.18 | 1.0 | 5 | -41.0 | same-strand | Permease MlaE |
| 5 | PF00005.29 | 1.0 | 5 | 18.0 | same-strand | ABC transporter |
| 6 | PF01699.26 | 1.0 | 5 | 1037.0 | opposite-strand | Sodium/calcium exchanger protein |
| 7 | PF01380.24 | 1.0 | 5 | 2028.0 | opposite-strand | SIS domain |
| 8 | PF00571.30 | 1.0 | 5 | 2028.0 | opposite-strand | CBS domain |
| 9 | PF06835.15 | 0.8 | 4 | 3598 | opposite-strand | Lipopolysaccharide-assembly, LptC-related |
++ More..