Result : EXP00318
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00318 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 3796905 |
| Right | 3796949 |
| Strand | - |
| Nucleotide Sequence | ATGTTTTACCTTTATAATGATGATAACTTTTCCAAAACTGCTTGA |
| Sequence | MFYLYNDDNFSKTA |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 14 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3796905 | 3796949 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 77624 | 77668 | + | NZ_LR134340.1 | Escherichia marmotae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00155.23 | 1.0 | 2 | 3743.0 | same-strand | Aminotransferase class I and II |
| 2 | PF01370.23 | 1.0 | 2 | 1986.0 | opposite-strand | NAD dependent epimerase/dehydratase family |
| 3 | PF16363.7 | 1.0 | 2 | 1986.0 | opposite-strand | GDP-mannose 4,6 dehydratase |
| 4 | PF01073.21 | 1.0 | 2 | 1986.0 | opposite-strand | 3-beta hydroxysteroid dehydrogenase/isomerase family |
| 5 | PF01075.19 | 1.0 | 2 | 930 | opposite-strand | Glycosyltransferase family 9 (heptosyltransferase) |
| 6 | PF06176.13 | 1.0 | 2 | 3320.0 | same-strand | Lipopolysaccharide core biosynthesis protein (WaaY) |
| 7 | PF01501.22 | 1.0 | 2 | 4036.0 | same-strand | Glycosyl transferase family 8 |
| 8 | PF08437.12 | 1.0 | 2 | 4036.0 | same-strand | Glycosyl transferase family 8 C-terminal |
++ More..