Result : EXP00315
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00315 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 2240412 |
| Right | 2240465 |
| Strand | - |
| Nucleotide Sequence | ATGGAAGAACGAATTTTAAAAAGTGAGCTTCGGCGTTCAGTAACACTTCATTAA |
| Sequence | MEERILKSELRRSVTLH |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 17 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2975541 | 2975594 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 2240412 | 2240465 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 2262971 | 2263024 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 1668150 | 1668203 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 2787073 | 2787126 | - | NZ_LR134340.1 | Escherichia marmotae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF14697.8 | 0.75 | 3 | 3843.0 | opposite-strand | 4Fe-4S dicluster domain |
| 2 | PF00037.29 | 0.75 | 3 | 3843.0 | opposite-strand | 4Fe-4S binding domain |
| 3 | PF12838.9 | 0.75 | 3 | 3843.0 | opposite-strand | 4Fe-4S dicluster domain |
| 4 | PF02653.18 | 0.75 | 3 | 2659.0 | same-strand | Branched-chain amino acid transport system / permease component |
| 5 | PF00005.29 | 1.0 | 4 | 1123 | same-strand | ABC transporter |
| 6 | PF13407.8 | 1.0 | 4 | 113.0 | same-strand | Periplasmic binding protein domain |
| 7 | PF13377.8 | 1.0 | 4 | 113.0 | same-strand | Periplasmic binding protein-like domain |
| 8 | PF00356.23 | 1.0 | 4 | 163 | same-strand | Bacterial regulatory proteins, lacI family |
| 9 | PF04235.14 | 0.75 | 3 | 1344.5 | same-strand | Protein of unknown function (DUF418) |
| 10 | PF01227.24 | 1.0 | 4 | 2518 | same-strand | GTP cyclohydrolase I |
++ More..