Result : EXP00314

Protein Information

• Protein name: EXP00314
• NCBI Accession ID: NC_000913.3
• Organism: Escherichia coli str. K-12 substr. MG1655
• Left: 2629014
• Right: 2629052
• Strand: -
• Nucleotide Sequence: ATGACACTTAGAATCAATGCTCTCTATAGTGATGAATAA
• Sequence: MTLRINALYSDE
• Source of smORF: Ribo-seq
• Pubmed ID: 30904393 27013550
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 12

Conservation Analysis

No. of Species: 4

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	3345291	3345329	-	NC_002695.2	Escherichia coli O157:H7 str. Sakai
2	2629014	2629052	-	NC_000913.3	Escherichia coli str. K-12 substr. MG1655
3	2618464	2618502	-	NC_004337.2	Shigella flexneri 2a str. 301
4	1118243	1118281	+	NZ_CP061527.1	Shigella dysenteriae
5	3154729	3154767	-	NZ_LR134340.1	Escherichia marmotae

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_002695.2

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF02541.18	1.0	4	2363	opposite-strand	Ppx/GppA phosphatase family
2	PF05231.16	1.0	4	76	same-strand	MASE1
3	PF00563.22	1.0	4	76	same-strand	EAL domain
4	PF11119.10	0.75	3	256.0	opposite-strand	Protein of unknown function (DUF2633)
5	PF05433.17	0.75	3	743.0	opposite-strand	Glycine zipper 2TM domain
6	PF13488.8	0.75	3	743.0	opposite-strand	Glycine zipper
7	PF13441.8	0.75	3	743.0	opposite-strand	YMGG-like Gly-zipper
8	PF17358.4	0.75	3	1274.0	opposite-strand	Family of unknown function (DUF5384)
9	PF00958.24	0.75	3	1907.0	same-strand	GMP synthase C terminal domain
10	PF00117.30	0.75	3	1907.0	same-strand	Glutamine amidotransferase class-I