Result : EXP00311

Protein Information

• Protein name: EXP00311
• NCBI Accession ID: NC_000913.3
• Organism: Escherichia coli str. K-12 substr. MG1655
• Left: 161165
• Right: 161203
• Strand: -
• Nucleotide Sequence: ATGAATCAATTTCAGAACTGTCAGGCTATAGCTCGCTGA
• Sequence: MNQFQNCQAIAR
• Source of smORF: Ribo-seq
• Pubmed ID: 30904393 27013550
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 12

Conservation Analysis

No. of Species: 3

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	165488	165526	-	NC_002695.2	Escherichia coli O157:H7 str. Sakai
2	161165	161203	-	NC_000913.3	Escherichia coli str. K-12 substr. MG1655
3	152943	152981	-	NC_004337.2	Shigella flexneri 2a str. 301
4	3452782	3452820	+	NZ_CP061527.1	Shigella dysenteriae

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_002695.2

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF01288.22	1.0	3	3433.0	same-strand	7,8-dihydro-6-hydroxymethylpterin-pyrophosphokinase (HPPK)
2	PF12626.9	1.0	3	2072.0	same-strand	Polymerase A arginine-rich C-terminus
3	PF01743.22	1.0	3	2072.0	same-strand	Poly A polymerase head domain
4	PF12627.9	1.0	3	2072.0	same-strand	Probable RNA and SrmB- binding site of polymerase A
5	PF00749.23	1.0	3	1053.0	same-strand	tRNA synthetases class I (E and Q), catalytic domain
6	PF01258.19	1.0	3	561.0	same-strand	Prokaryotic dksA/traR C4-type zinc finger
7	PF03749.15	1.0	3	-38.0	same-strand	Sugar fermentation stimulation protein RE domain
8	PF17746.3	1.0	3	-38.0	same-strand	SfsA N-terminal OB domain
9	PF02834.18	1.0	3	298.0	same-strand	LigT like Phosphoesterase
10	PF08482.12	0.67	2	902	opposite-strand	ATP-dependent helicase C-terminal
11	PF00271.33	1.0	3	902.0	opposite-strand	Helicase conserved C-terminal domain
12	PF00270.31	1.0	3	902.0	opposite-strand	DEAD/DEAH box helicase
13	PF00912.24	0.67	2	3527	opposite-strand	Transglycosylase
14	PF14812.8	0.67	2	3527	opposite-strand	Transmembrane domain of transglycosylase PBP1 at N-terminal
15	PF14814.8	0.67	2	3527	opposite-strand	Bifunctional transglycosylase second domain
16	PF00905.24	0.67	2	3527	opposite-strand	Penicillin binding protein transpeptidase domain
17	PF00593.26	0.67	2	6281	opposite-strand	TonB dependent receptor
18	PF07715.17	0.67	2	6281	opposite-strand	TonB-dependent Receptor Plug Domain
19	PF00005.29	0.67	2	8575	opposite-strand	ABC transporter