| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00306 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 2433913 |
| Right | 2433990 |
| Strand | - |
| Nucleotide Sequence | ATGGCATTATGCGTCCCCAAAGATAAAACTGGCATCGAACCAGGTTCAGACAGAAAGGTCCCTAATGAGCTGGATTGA |
| Sequence | MALCVPKDKTGIEPGSDRKVPNELD |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 25 |
| Conservation Analysis |
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3160400 | 3160477 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 2435320 | 2435397 | - | NZ_AP014857.1 | Escherichia albertii |
| 3 | 2433913 | 2433990 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 4 | 2442024 | 2442101 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 5 | 4364739 | 4364816 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 6 | 1291209 | 1291286 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 7 | 2977594 | 2977671 | - | NZ_LR134340.1 | Escherichia marmotae |
| 8 | 2058744 | 2058821 | - | NZ_CP023529.1 | Lelliottia amnigena |
| 9 | 3583288 | 3583365 | - | NZ_CP043318.1 | Enterobacter chengduensis |
| 10 | 207590 | 207667 | + | NZ_CP045769.1 | Enterobacter cancerogenus |
| 11 | 3414458 | 3414535 | - | NZ_CP009756.1 | Enterobacter cloacae |
| 12 | 3984743 | 3984820 | + | NZ_CP025034.2 | Enterobacter sp. SGAir0187 |
| 13 | 3298863 | 3298940 | - | NZ_CP017184.1 | Enterobacter roggenkampii |
| 14 | 3303546 | 3303623 | - | NZ_CP027986.1 | Enterobacter sichuanensis |
| 15 | 3275298 | 3275375 | - | NZ_AP022508.1 | Enterobacter bugandensis |
| 16 | 1050785 | 1050862 | - | NZ_AP019007.1 | Enterobacter oligotrophicus |
| 17 | 2561275 | 2561352 | - | NZ_CP017279.1 | Enterobacter ludwigii |
| 18 | 3261482 | 3261559 | - | NC_015968.1 | Enterobacter soli |
| 19 | 1434195 | 1434260 | + | NZ_CP013990.1 | Leclercia adecarboxylata |
| 20 | 2821916 | 2821990 | + | NZ_CP023706.1 | Edwardsiella tarda |
| 21 | 1280987 | 1281064 | + | NZ_CP054058.1 | Scandinavium goeteborgense |
| 22 | 3488838 | 3488900 | - | NC_014306.1 | Erwinia billingiae Eb661 |
| Neighborhood Conservation Analysis |
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF13522.8 | 1.0 | 21 | 3673.0 | same-strand | Glutamine amidotransferase domain |
| 2 | PF13537.8 | 1.0 | 21 | 3673.0 | same-strand | Glutamine amidotransferase domain |
| 3 | PF02674.18 | 1.0 | 21 | 3147.5 | same-strand | Colicin V production protein |
| 4 | PF05036.15 | 1.0 | 21 | 2221.0 | same-strand | SPOR domain |
| 5 | PF17848.3 | 1.0 | 21 | -13.0 | same-strand | Acetyl-coA carboxylase zinc finger domain |
| 6 | PF09335.13 | 1.0 | 21 | 91.0 | same-strand | SNARE associated Golgi protein |
| 7 | PF01416.22 | 1.0 | 21 | 779.0 | same-strand | tRNA pseudouridine synthase |
| 8 | PF02774.20 | 1.0 | 21 | 1591.0 | same-strand | Semialdehyde dehydrogenase, dimerisation domain |
| 9 | PF01118.26 | 1.0 | 21 | 1591.0 | same-strand | Semialdehyde dehydrogenase, NAD binding domain |
| 10 | PF02826.21 | 0.86 | 18 | 2672 | same-strand | D-isomer specific 2-hydroxyacid dehydrogenase, NAD binding domain |
| 11 | PF11890.10 | 1.0 | 21 | 2672.0 | same-strand | Domain of unknown function (DUF3410) |
| 12 | PF00389.32 | 0.9 | 19 | 2672 | same-strand | D-isomer specific 2-hydroxyacid dehydrogenase, catalytic domain |