Result : EXP00304
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00304 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 2971499 |
| Right | 2971555 |
| Strand | - |
| Nucleotide Sequence | ATGGCAGAGGGAAGGGAAAAGGGAAAGAGAAAAATCTTAAGGCCAGCCGGATGCTGA |
| Sequence | MAEGREKGKRKILRPAGC |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 18 |
++ More..
| Conservation Analysis |
No. of Species: 5
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3694026 | 3694082 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 2971499 | 2971555 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 2931860 | 2931916 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 3455381 | 3455437 | - | NZ_LR134340.1 | Escherichia marmotae |
| 5 | 779930 | 779986 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 6 | 2895126 | 2895182 | - | NZ_AP014857.1 | Escherichia albertii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00293.30 | 1.0 | 5 | 2522.0 | same-strand | NUDIX domain |
| 2 | PF02976.17 | 1.0 | 5 | 1148.0 | opposite-strand | DNA mismatch repair enzyme MutH |
| 3 | PF03741.18 | 1.0 | 5 | 366.0 | opposite-strand | Integral membrane protein TerC family |
| 4 | PF06004.14 | 1.0 | 5 | 10.0 | opposite-strand | Bacterial protein of unknown function (DUF903) |
| 5 | PF00248.23 | 1.0 | 5 | 42.0 | opposite-strand | Aldo/keto reductase family |
| 6 | PF07690.18 | 1.0 | 5 | 1114.5 | same-strand | Major Facilitator Superfamily |
| 7 | PF00501.30 | 1.0 | 5 | 2300.0 | same-strand | AMP-binding enzyme |
| 8 | PF01553.23 | 1.0 | 5 | 2300.0 | same-strand | Acyltransferase |
| 9 | PF13377.8 | 0.8 | 4 | 5045 | opposite-strand | Periplasmic binding protein-like domain |
| 10 | PF00532.23 | 0.8 | 4 | 5045 | opposite-strand | Periplasmic binding proteins and sugar binding domain of LacI family |
| 11 | PF00356.23 | 0.8 | 4 | 5045 | opposite-strand | Bacterial regulatory proteins, lacI family |
| 12 | PF13407.8 | 0.8 | 4 | 5045 | opposite-strand | Periplasmic binding protein domain |
| 13 | PF02784.18 | 0.8 | 4 | 6083 | same-strand | Pyridoxal-dependent decarboxylase, pyridoxal binding domain |
| 14 | PF00278.24 | 0.8 | 4 | 6083 | same-strand | Pyridoxal-dependent decarboxylase, C-terminal sheet domain |
++ More..