Result : EXP00300
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00300 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 2662240 |
| Right | 2662281 |
| Strand | - |
| Nucleotide Sequence | ATGGCACTGAAGGTTAAATACCCGACTAAATCAGTCAAGTAA |
| Sequence | MALKVKYPTKSVK |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 13 |
++ More..
| Conservation Analysis |
No. of Species: 5
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2625262 | 2625303 | - | NZ_AP014857.1 | Escherichia albertii |
| 2 | 2662240 | 2662281 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 3383030 | 3383071 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 4 | 2647274 | 2647315 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 5 | 4166710 | 4166751 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 6 | 1081816 | 1081857 | + | NZ_CP061527.1 | Shigella dysenteriae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_AP014857.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF07743.15 | 1.0 | 5 | 2773.0 | same-strand | HSCB C-terminal oligomerisation domain |
| 2 | PF00226.33 | 1.0 | 5 | 2773.0 | same-strand | DnaJ domain |
| 3 | PF01521.22 | 1.0 | 5 | 2354.0 | same-strand | Iron-sulphur cluster biosynthesis |
| 4 | PF01592.18 | 1.0 | 5 | 1951.0 | same-strand | NifU-like N terminal domain |
| 5 | PF00266.21 | 1.0 | 5 | 709.0 | same-strand | Aminotransferase class-V |
| 6 | PF02082.22 | 1.0 | 5 | 109.0 | same-strand | Iron-dependent Transcriptional regulator |
| 7 | PF00588.21 | 1.0 | 5 | 135.0 | same-strand | SpoU rRNA Methylase family |
| 8 | PF00459.27 | 1.0 | 5 | 992.5 | opposite-strand | Inositol monophosphatase family |
| 9 | PF00326.23 | 1.0 | 5 | 1940.5 | opposite-strand | Prolyl oligopeptidase family |
| 10 | PF00874.22 | 1.0 | 5 | 2985.5 | opposite-strand | PRD domain |
| 11 | PF12832.9 | 1.0 | 5 | 4257.5 | same-strand | MFS 1 like family |
| 12 | PF01306.21 | 1.0 | 5 | 4257.5 | same-strand | LacY proton/sugar symporter |
| 13 | PF07690.18 | 1.0 | 5 | 4257.5 | same-strand | Major Facilitator Superfamily |
++ More..