Result : EXP00298
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00298 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 2461019 |
| Right | 2461093 |
| Strand | - |
| Nucleotide Sequence | ATGGATTCGGGTGAATTTTGTTTTAGATCATTTTTAAGTGTGATTTCGGTCACTTATCCGATTTTGCAGAATTAA |
| Sequence | MDSGEFCFRSFLSVISVTYPILQN |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 24 |
++ More..
| Conservation Analysis |
No. of Species: 11
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3187567 | 3187641 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 2461019 | 2461093 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 1263822 | 1263896 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 4 | 430744 | 430812 | + | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 5 | 2462553 | 2462621 | - | NZ_AP014857.1 | Escherichia albertii |
| 6 | 1141803 | 1141871 | - | NZ_CP033744.1 | Citrobacter freundii |
| 7 | 3925934 | 3926002 | + | NZ_CP044098.1 | Citrobacter portucalensis |
| 8 | 2900287 | 2900355 | - | NC_013716.1 | Citrobacter rodentium ICC168 |
| 9 | 1414434 | 1414502 | + | NZ_CP013990.1 | Leclercia adecarboxylata |
| 10 | 21118 | 21186 | + | NZ_CP038469.1 | Citrobacter tructae |
| 11 | 1684207 | 1684275 | + | NZ_CP036175.1 | Klebsiella huaxiensis |
| 12 | 2160980 | 2161048 | + | NZ_CP045205.1 | Citrobacter telavivensis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_009792.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02737.20 | 1.0 | 11 | 1857.0 | same-strand | 3-hydroxyacyl-CoA dehydrogenase, NAD binding domain |
| 2 | PF00725.24 | 1.0 | 11 | 1857.0 | same-strand | 3-hydroxyacyl-CoA dehydrogenase, C-terminal domain |
| 3 | PF00108.25 | 1.0 | 11 | 547.0 | same-strand | Thiolase, N-terminal domain |
| 4 | PF02803.20 | 1.0 | 11 | 547.0 | same-strand | Thiolase, C-terminal domain |
| 5 | PF04175.14 | 1.0 | 11 | 85.0 | same-strand | Protein of unknown function (DUF406) |
| 6 | PF03349.18 | 1.0 | 11 | 219.0 | opposite-strand | Outer membrane protein transport protein (OMPP1/FadL/TodX) |
| 7 | PF04333.15 | 1.0 | 11 | 1633.0 | same-strand | MlaA lipoprotein |
| 8 | PF01226.19 | 0.82 | 9 | 2669.5 | opposite-strand | Formate/nitrite transporter |
| 9 | PF01713.23 | 0.73 | 8 | 4778.0 | opposite-strand | Smr domain |
++ More..