Result : EXP00296

Protein Information

• Protein name: EXP00296
• NCBI Accession ID: NC_000913.3
• Organism: Escherichia coli str. K-12 substr. MG1655
• Left: 3000150
• Right: 3000197
• Strand: -
• Nucleotide Sequence: ATGACGTTAAAAAAACACAGATATGATACGAAACAGGACTCTGAATAG
• Sequence: MTLKKHRYDTKQDSE
• Source of smORF: Ribo-seq
• Pubmed ID: 30904393 27013550
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 15

Conservation Analysis

No. of Species: 2

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	3000150	3000197	-	NC_000913.3	Escherichia coli str. K-12 substr. MG1655
2	2958817	2958864	-	NC_004337.2	Shigella flexneri 2a str. 301
3	3738608	3738655	-	NC_002695.2	Escherichia coli O157:H7 str. Sakai

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_000913.3

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF00665.28	1.0	2	3633.5	same-strand	Integrase core domain
2	PF13683.8	1.0	2	4167	same-strand	Integrase core domain
3	PF01551.24	1.0	2	259	same-strand	Peptidase family M23
4	PF01476.22	1.0	2	259	same-strand	LysM domain
5	PF02738.20	1.0	2	109	opposite-strand	Molybdopterin-binding domain of aldehyde dehydrogenase
6	PF01315.24	1.0	2	109	opposite-strand	Aldehyde oxidase and xanthine dehydrogenase, a/b hammerhead domain
7	PF00941.23	1.0	2	2417	opposite-strand	FAD binding domain in molybdopterin dehydrogenase
8	PF03450.19	1.0	2	2417	opposite-strand	CO dehydrogenase flavoprotein C-terminal domain
9	PF01799.22	1.0	2	3292	opposite-strand	[2Fe-2S] binding domain