Result : EXP00292
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00292 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 1434955 |
| Right | 1435008 |
| Strand | - |
| Nucleotide Sequence | ATGTCGCAAAATCAAGAAATTAGTAAGAAAGAACAATACAACCTGAACAAGTAA |
| Sequence | MSQNQEISKKEQYNLNK |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 17 |
++ More..
| Conservation Analysis |
No. of Species: 5
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1409136 | 1409189 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 2 | 1434955 | 1435008 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 2267484 | 2267537 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 4 | 259478 | 259531 | + | NZ_CP033744.1 | Citrobacter freundii |
| 5 | 2294906 | 2294959 | + | NZ_LR134340.1 | Escherichia marmotae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LR134340.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00950.19 | 0.6 | 3 | 2507.5 | same-strand | ABC 3 transport family |
| 2 | PF00005.29 | 0.6 | 3 | 1270 | same-strand | ABC transporter |
| 3 | PF02463.21 | 0.6 | 3 | 1270 | same-strand | RecF/RecN/SMC N terminal domain |
| 4 | PF01297.19 | 0.6 | 3 | 356 | same-strand | Zinc-uptake complex component A periplasmic |
| 5 | PF00582.28 | 0.8 | 4 | 177.0 | same-strand | Universal stress protein family |
| 6 | PF00267.23 | 0.6 | 3 | 752 | same-strand | Gram-negative porin |
| 7 | PF13609.8 | 0.6 | 3 | 752 | same-strand | Gram-negative porin |
| 8 | PF01855.21 | 0.6 | 3 | 2252 | same-strand | Pyruvate flavodoxin/ferredoxin oxidoreductase, thiamine diP-bdg |
| 9 | PF01558.20 | 0.6 | 3 | 2252 | same-strand | Pyruvate ferredoxin/flavodoxin oxidoreductase |
| 10 | PF10371.11 | 0.6 | 3 | 2252 | same-strand | Domain of unknown function |
| 11 | PF13484.8 | 0.6 | 3 | 2252 | same-strand | 4Fe-4S double cluster binding domain |
| 12 | PF12838.9 | 0.6 | 3 | 2252 | same-strand | 4Fe-4S dicluster domain |
| 13 | PF00037.29 | 0.6 | 3 | 2252 | same-strand | 4Fe-4S binding domain |
| 14 | PF13187.8 | 0.6 | 3 | 2252 | same-strand | 4Fe-4S dicluster domain |
| 15 | PF14697.8 | 0.6 | 3 | 2252 | same-strand | 4Fe-4S dicluster domain |
| 16 | PF12837.9 | 0.6 | 3 | 2252 | same-strand | 4Fe-4S binding domain |
| 17 | PF13237.8 | 0.6 | 3 | 2252 | same-strand | 4Fe-4S dicluster domain |
| 18 | PF13534.8 | 0.6 | 3 | 2252 | same-strand | 4Fe-4S dicluster domain |
| 19 | PF13183.8 | 0.6 | 3 | 2252 | same-strand | 4Fe-4S dicluster domain |
| 20 | PF03891.17 | 0.6 | 3 | 6050 | opposite-strand | Domain of unknown function (DUF333) |
++ More..