Result : EXP00287
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00287 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 585024 |
| Right | 585101 |
| Strand | - |
| Nucleotide Sequence | ATGATATCGGCTCCTTCCCGAATGGAGAAAGAGCAATCGGCTACAAACAACGTTTTAAAATGCCCTACATTGGCTTGA |
| Sequence | MISAPSRMEKEQSATNNVLKCPTLA |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 25 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1661659 | 1661736 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 585024 | 585101 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 1884651 | 1884728 | - | NZ_LR134340.1 | Escherichia marmotae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01278.22 | 1.0 | 2 | -77 | same-strand | Omptin family |
| 2 | PF12833.9 | 1.0 | 2 | 594 | opposite-strand | Helix-turn-helix domain |
| 3 | PF00165.25 | 1.0 | 2 | 594 | opposite-strand | Bacterial regulatory helix-turn-helix proteins, AraC family |
++ More..