Result : EXP00286
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00286 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 2323264 |
| Right | 2323329 |
| Strand | - |
| Nucleotide Sequence | ATGGGGATTTATAAGGAGAATGAGCGGCTATGCAGAAAATTGCGCACTGTGCAAATTTCTGCATAG |
| Sequence | MGIYKENERLCRKLRTVQISA |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 21 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2323264 | 2323329 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 2865729 | 2865788 | - | NZ_LR134340.1 | Escherichia marmotae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF16359.7 | 1.0 | 2 | 7073.5 | opposite-strand | RcsD-ABL domain |
| 2 | PF02518.28 | 1.0 | 2 | 3388.0 | opposite-strand | Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase |
| 3 | PF00072.26 | 1.0 | 2 | 3388.0 | opposite-strand | Response regulator receiver domain |
| 4 | PF00196.21 | 1.0 | 2 | 6406.5 | opposite-strand | Bacterial regulatory proteins, luxR family |
| 5 | PF04545.18 | 1.0 | 2 | 6406.5 | opposite-strand | Sigma-70, region 4 |
| 6 | PF08281.14 | 1.0 | 2 | 6406.5 | opposite-strand | Sigma-70, region 4 |
| 7 | PF09456.12 | 1.0 | 2 | 3388.0 | same-strand | RcsC Alpha-Beta-Loop (ABL) |
| 8 | PF00512.27 | 1.0 | 2 | 2391.5 | both-strands | His Kinase A (phospho-acceptor) domain |
| 9 | PF00989.27 | 1.0 | 2 | 1395.0 | opposite-strand | PAS fold |
| 10 | PF13426.9 | 1.0 | 2 | 1395.0 | opposite-strand | PAS domain |
| 11 | PF08448.12 | 1.0 | 2 | 1395.0 | opposite-strand | PAS fold |
| 12 | PF00158.28 | 1.0 | 2 | 13.0 | opposite-strand | Sigma-54 interaction domain |
| 13 | PF14532.8 | 1.0 | 2 | 13.0 | opposite-strand | Sigma-54 interaction domain |
| 14 | PF02954.21 | 1.0 | 2 | 13.0 | opposite-strand | Bacterial regulatory protein, Fis family |
| 15 | PF07728.16 | 1.0 | 2 | 13.0 | opposite-strand | AAA domain (dynein-related subfamily) |
| 16 | PF00004.31 | 1.0 | 2 | 13.0 | opposite-strand | ATPase family associated with various cellular activities (AAA) |
| 17 | PF18024.3 | 1.0 | 2 | 13.0 | opposite-strand | Helix-turn-helix domain |
| 18 | PF01144.25 | 1.0 | 2 | 452.0 | opposite-strand | Coenzyme A transferase |
| 19 | PF02667.16 | 1.0 | 2 | 1430.0 | opposite-strand | Short chain fatty acid transporter |
| 20 | PF00108.25 | 1.0 | 2 | 2783.0 | opposite-strand | Thiolase, N-terminal domain |
| 21 | PF02803.20 | 1.0 | 2 | 2783.0 | opposite-strand | Thiolase, C-terminal domain |
| 22 | PF09906.11 | 1.0 | 2 | 4041.0 | same-strand | Uncharacterized protein conserved in bacteria (DUF2135) |
++ More..