Result : EXP00284
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00284 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 890681 |
| Right | 890737 |
| Strand | - |
| Nucleotide Sequence | TTGGTCGTTCGGGTTGCCCTTACTGTGTGCGTGCAAAAGATCTGGCTGAGAAATTGA |
| Sequence | LVVRVALTVCVQKIWLRN |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 18 |
++ More..
| Conservation Analysis |
No. of Species: 12
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1015969 | 1016025 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 890681 | 890737 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 836098 | 836154 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 2919963 | 2920019 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 3287871 | 3287927 | + | NZ_CP013990.1 | Leclercia adecarboxylata |
| 6 | 4025809 | 4025865 | - | NZ_AP019007.1 | Enterobacter oligotrophicus |
| 7 | 1520948 | 1521004 | - | NZ_CP009756.1 | Enterobacter cloacae |
| 8 | 1491350 | 1491406 | - | NZ_CP027986.1 | Enterobacter sichuanensis |
| 9 | 1964555 | 1964611 | + | NZ_CP045769.1 | Enterobacter cancerogenus |
| 10 | 679984 | 680040 | - | NZ_CP017279.1 | Enterobacter ludwigii |
| 11 | 1509291 | 1509347 | - | NZ_AP022508.1 | Enterobacter bugandensis |
| 12 | 1460241 | 1460297 | - | NZ_CP017184.1 | Enterobacter roggenkampii |
| 13 | 3947385 | 3947441 | + | NZ_CP045205.1 | Citrobacter telavivensis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF06826.14 | 1.0 | 12 | 876 | same-strand | Predicted Permease Membrane Region |
| 2 | PF02080.23 | 1.0 | 12 | 876 | same-strand | TrkA-C domain |
| 3 | PF11045.10 | 1.0 | 12 | 228 | opposite-strand | Putative inner membrane protein of Enterobacteriaceae |
| 4 | PF00462.26 | 1.0 | 12 | -56 | same-strand | Glutaredoxin |
| 5 | PF13098.8 | 0.75 | 9 | -56 | same-strand | Thioredoxin-like domain |
| 6 | PF00881.26 | 1.0 | 12 | 202 | opposite-strand | Nitroreductase family |
| 7 | PF08443.13 | 1.0 | 12 | 994 | opposite-strand | RimK-like ATP-grasp domain |
| 8 | PF18030.3 | 1.0 | 12 | 994 | opposite-strand | RimK PreATP-grasp domain |
| 9 | PF02955.18 | 1.0 | 12 | 994 | opposite-strand | Prokaryotic glutathione synthetase, ATP-grasp domain |
| 10 | PF02655.16 | 1.0 | 12 | 994 | opposite-strand | ATP-grasp domain |
| 11 | PF10722.11 | 1.0 | 12 | 1960 | opposite-strand | Putative bacterial sensory transduction regulator |
| 12 | PF13416.8 | 0.83 | 10 | 2787 | opposite-strand | Bacterial extracellular solute-binding protein |
| 13 | PF13343.8 | 0.83 | 10 | 2787 | opposite-strand | Bacterial extracellular solute-binding protein |
| 14 | PF01547.27 | 0.83 | 10 | 2787 | opposite-strand | Bacterial extracellular solute-binding protein |
| 15 | PF13531.8 | 0.83 | 10 | 2787 | opposite-strand | Bacterial extracellular solute-binding protein |
++ More..