Result : EXP00283
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00283 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 559415 |
| Right | 559477 |
| Strand | - |
| Nucleotide Sequence | ATGAACATTGATATAGTTACCGGATCGCGAAAACTTGAGTGTGTCCGGCGCTTCTGCGGGTAA |
| Sequence | MNIDIVTGSRKLECVRRFCG |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 20 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 559415 | 559477 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 477936 | 477998 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 3 | 651868 | 651930 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 4 | 951587 | 951649 | + | NC_007940.1 | Rickettsia bellii RML369-C |
| 5 | 775174 | 775236 | + | NC_007940.1 | Rickettsia bellii RML369-C |
| 6 | 978715 | 978789 | + | NC_007940.1 | Rickettsia bellii RML369-C |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_004337.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF04307.16 | 0.67 | 2 | 2862 | same-strand | LexA-binding, inner membrane-associated putative hydrolase |
| 2 | PF13275.8 | 0.67 | 2 | 2542 | same-strand | S4 domain |
| 3 | PF02882.21 | 0.67 | 2 | 1674 | same-strand | Tetrahydrofolate dehydrogenase/cyclohydrolase, NAD(P)-binding domain |
| 4 | PF00763.25 | 0.67 | 2 | 1674 | same-strand | Tetrahydrofolate dehydrogenase/cyclohydrolase, catalytic domain |
| 5 | PF00419.22 | 0.67 | 2 | 2842 | opposite-strand | Fimbrial protein |
| 6 | PF00345.22 | 0.67 | 2 | -62 | opposite-strand | Pili and flagellar-assembly chaperone, PapD N-terminal domain |
| 7 | PF02753.19 | 0.67 | 2 | -62 | opposite-strand | Pili assembly chaperone PapD, C-terminal domain |
| 8 | PF13954.8 | 0.67 | 2 | 220 | opposite-strand | PapC N-terminal domain |
| 9 | PF00165.25 | 0.67 | 2 | 3716.0 | same-strand | Bacterial regulatory helix-turn-helix proteins, AraC family |
| 10 | PF12833.9 | 0.67 | 2 | 3716.0 | same-strand | Helix-turn-helix domain |
++ More..