Result : EXP00281
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00281 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 3664691 |
| Right | 3664750 |
| Strand | - |
| Nucleotide Sequence | ATGCAAAACTACTTTGTGGATAAATTTTGGTCCTACCAAATCTGGCAGTTTTTGCGCTAA |
| Sequence | MQNYFVDKFWSYQIWQFLR |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 19 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4406951 | 4407010 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 3664691 | 3664750 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 3698357 | 3698416 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF12833.9 | 1.0 | 2 | 154.5 | same-strand | Helix-turn-helix domain |
| 2 | PF00165.25 | 1.0 | 2 | 236 | same-strand | Bacterial regulatory helix-turn-helix proteins, AraC family |
| 3 | PF00282.21 | 1.0 | 2 | 1430 | same-strand | Pyridoxal-dependent decarboxylase conserved domain |
| 4 | PF03150.16 | 1.0 | 2 | 3041 | same-strand | Di-haem cytochrome c peroxidase |
| 5 | PF14376.8 | 1.0 | 2 | 3041 | same-strand | Haem-binding domain |
| 6 | PF00034.23 | 1.0 | 2 | 3041 | same-strand | Cytochrome c |
++ More..