Result : EXP00280
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00280 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 2512687 |
| Right | 2512776 |
| Strand | - |
| Nucleotide Sequence | ATGAATTTGATAATCATTCTCGTTTGGCATAGCATGAAACATAGCAAAGGCTATGTTTTAGAGGCACAAGATGACGAACTATCGCGTTGA |
| Sequence | MNLIIILVWHSMKHSKGYVLEAQDDELSR |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 29 |
++ More..
| Conservation Analysis |
No. of Species: 7
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3240954 | 3241043 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 2512687 | 2512776 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 1219787 | 1219876 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 4 | 381585 | 381674 | + | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 5 | 4736519 | 4736608 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
| 6 | 2524952 | 2525029 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 7 | 500551 | 500628 | - | NZ_CP053416.1 | Salmonella bongori |
| 8 | 2049312 | 2049401 | + | NZ_CP045205.1 | Citrobacter telavivensis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00654.22 | 0.71 | 5 | 4567.5 | opposite-strand | Voltage gated chloride channel |
| 2 | PF10697.11 | 0.71 | 5 | 1307.5 | opposite-strand | Protein of unknown function (DUF2502) |
| 3 | PF01566.20 | 1.0 | 7 | -19.0 | same-strand | Natural resistance-associated macrophage protein |
| 4 | PF07662.15 | 1.0 | 7 | 272.5 | opposite-strand | Na+ dependent nucleoside transporter C-terminus |
| 5 | PF01773.22 | 1.0 | 7 | 272.5 | opposite-strand | Na+ dependent nucleoside transporter N-terminus |
| 6 | PF07670.16 | 1.0 | 7 | 272.5 | opposite-strand | Nucleoside recognition |
| 7 | PF05231.16 | 0.86 | 6 | 1528 | same-strand | MASE1 |
| 8 | PF00563.22 | 0.86 | 6 | 1528 | same-strand | EAL domain |
| 9 | PF07037.13 | 0.86 | 6 | 4708 | opposite-strand | Putative transcription regulator (DUF1323) |
++ More..