Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00276 |
NCBI Accession ID | NC_000913.3 |
Organism | Escherichia coli str. K-12 substr. MG1655 |
Left | 1492256 |
Right | 1492321 |
Strand | - |
Nucleotide Sequence | ATGGCTAAACTGGCTAACCCGAATGACGAAAAATTCTGGAAAACAGCACGCAATTTCGTGAAGTGA |
Sequence | MAKLANPNDEKFWKTARNFVK |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 30904393 27013550 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 21 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 1492256 | 1492321 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
2 | 1827624 | 1827689 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
3 | 2000806 | 2000871 | - | NZ_CP061527.1 | Shigella dysenteriae |
4 | 2009902 | 2009967 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF01292.22 | 0.67 | 2 | 824 | opposite-strand | Prokaryotic cytochrome b561 |
2 | PF00015.23 | 1.0 | 3 | 149.0 | opposite-strand | Methyl-accepting chemotaxis protein (MCP) signalling domain |
3 | PF02203.17 | 0.67 | 2 | 149 | opposite-strand | Tar ligand binding domain homologue |
4 | PF00672.27 | 1.0 | 3 | 149.0 | opposite-strand | HAMP domain |
5 | PF03466.22 | 0.67 | 2 | 1827 | same-strand | LysR substrate binding domain |
6 | PF00126.29 | 0.67 | 2 | 1827 | same-strand | Bacterial regulatory helix-turn-helix protein, lysR family |
7 | PF07063.15 | 0.67 | 2 | 2967 | opposite-strand | Domain of unknown function (DUF1338) |
8 | PF04349.14 | 0.67 | 2 | 4571 | opposite-strand | Periplasmic glucan biosynthesis protein, MdoG |
9 | PF04325.15 | 0.67 | 2 | 6330 | opposite-strand | Protein of unknown function (DUF465) |
10 | PF01848.18 | 0.67 | 2 | 1178.5 | same-strand | Hok/gef family |
11 | PF00044.26 | 0.67 | 2 | 1543.0 | same-strand | Glyceraldehyde 3-phosphate dehydrogenase, NAD binding domain |