Result : EXP00276
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00276 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 1492256 |
| Right | 1492321 |
| Strand | - |
| Nucleotide Sequence | ATGGCTAAACTGGCTAACCCGAATGACGAAAAATTCTGGAAAACAGCACGCAATTTCGTGAAGTGA |
| Sequence | MAKLANPNDEKFWKTARNFVK |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 21 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1492256 | 1492321 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 1827624 | 1827689 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 3 | 2000806 | 2000871 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 4 | 2009902 | 2009967 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01292.22 | 0.67 | 2 | 824 | opposite-strand | Prokaryotic cytochrome b561 |
| 2 | PF00015.23 | 1.0 | 3 | 149.0 | opposite-strand | Methyl-accepting chemotaxis protein (MCP) signalling domain |
| 3 | PF02203.17 | 0.67 | 2 | 149 | opposite-strand | Tar ligand binding domain homologue |
| 4 | PF00672.27 | 1.0 | 3 | 149.0 | opposite-strand | HAMP domain |
| 5 | PF03466.22 | 0.67 | 2 | 1827 | same-strand | LysR substrate binding domain |
| 6 | PF00126.29 | 0.67 | 2 | 1827 | same-strand | Bacterial regulatory helix-turn-helix protein, lysR family |
| 7 | PF07063.15 | 0.67 | 2 | 2967 | opposite-strand | Domain of unknown function (DUF1338) |
| 8 | PF04349.14 | 0.67 | 2 | 4571 | opposite-strand | Periplasmic glucan biosynthesis protein, MdoG |
| 9 | PF04325.15 | 0.67 | 2 | 6330 | opposite-strand | Protein of unknown function (DUF465) |
| 10 | PF01848.18 | 0.67 | 2 | 1178.5 | same-strand | Hok/gef family |
| 11 | PF00044.26 | 0.67 | 2 | 1543.0 | same-strand | Glyceraldehyde 3-phosphate dehydrogenase, NAD binding domain |
++ More..