Result : EXP00270

Protein Information

• Protein name: EXP00270
• NCBI Accession ID: NC_000913.3
• Organism: Escherichia coli str. K-12 substr. MG1655
• Left: 4190442
• Right: 4190498
• Strand: -
• Nucleotide Sequence: ATGATAGAGACGAAAATAAGAACACATGTTCTCATCTTCCAGGATGCAGCAGACTGA
• Sequence: MIETKIRTHVLIFQDAAD
• Source of smORF: Ribo-seq
• Pubmed ID: 30904393 27013550
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 18

Conservation Analysis

No. of Species: 2

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	4999394	4999450	-	NC_002695.2	Escherichia coli O157:H7 str. Sakai
2	4190442	4190498	-	NC_000913.3	Escherichia coli str. K-12 substr. MG1655
3	123712	123768	-	NZ_CP061527.1	Shigella dysenteriae

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_002695.2

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF04997.14	1.0	2	869	opposite-strand	RNA polymerase Rpb1, domain 1
2	PF04998.19	1.0	2	869	opposite-strand	RNA polymerase Rpb1, domain 5
3	PF04983.20	1.0	2	869	opposite-strand	RNA polymerase Rpb1, domain 3
4	PF05000.19	1.0	2	869	opposite-strand	RNA polymerase Rpb1, domain 4
5	PF06968.15	1.0	2	237	same-strand	Biotin and Thiamin Synthesis associated domain
6	PF04055.23	1.0	2	237	same-strand	Radical SAM superfamily
7	PF05690.16	1.0	2	1367	same-strand	Thiazole biosynthesis protein ThiG
8	PF02597.22	1.0	2	2139	same-strand	ThiS family
9	PF00899.23	1.0	2	2323	same-strand	ThiF family
10	PF13241.8	1.0	2	2323	same-strand	Putative NAD(P)-binding
11	PF02581.19	1.0	2	3071	same-strand	Thiamine monophosphate synthase