Result : EXP00264
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00264 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 2079427 |
| Right | 2079477 |
| Strand | - |
| Nucleotide Sequence | ATGATAGTGAAAAGGGATAAAAGCATTGTCATCTGCGGCAGCTATGAGTAA |
| Sequence | MIVKRDKSIVICGSYE |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 16 |
++ More..
| Conservation Analysis |
No. of Species: 5
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2632708 | 2632758 | - | NZ_LR134340.1 | Escherichia marmotae |
| 2 | 2079427 | 2079477 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 2086946 | 2086996 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 2056959 | 2057009 | - | NZ_AP014857.1 | Escherichia albertii |
| 5 | 1579319 | 1579369 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 6 | 2752069 | 2752119 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LR134340.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF04363.14 | 1.0 | 5 | 66.0 | same-strand | Protein of unknown function (DUF496) |
| 2 | PF13515.8 | 0.8 | 4 | 56 | same-strand | Fusaric acid resistance protein-like |
| 3 | PF06445.17 | 0.6 | 3 | 1314.5 | same-strand | GyrI-like small molecule binding domain |
| 4 | PF14526.8 | 0.6 | 3 | 1314.5 | same-strand | Integron-associated effector binding protein |
| 5 | PF00768.22 | 0.8 | 4 | 1909 | same-strand | D-alanyl-D-alanine carboxypeptidase |
| 6 | PF07943.15 | 0.8 | 4 | 1909 | same-strand | Penicillin-binding protein 5, C-terminal domain |
| 7 | PF13354.8 | 0.8 | 4 | 1909 | same-strand | Beta-lactamase enzyme family |
| 8 | PF08411.12 | 0.8 | 4 | 3280 | opposite-strand | Exonuclease C-terminal |
| 9 | PF00929.26 | 0.8 | 4 | 3280 | opposite-strand | Exonuclease |
++ More..