Result : EXP00261
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00261 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 1113788 |
| Right | 1113868 |
| Strand | - |
| Nucleotide Sequence | TTGAGCCACCGCTGGATACCGAGGAAGGACGCGCAGCAGCTGATGAGTGGGATGAACGTTAATCACTCATACGGGCCATGA |
| Sequence | LSHRWIPRKDAQQLMSGMNVNHSYGP |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 26 |
++ More..
| Conservation Analysis |
No. of Species: 9
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1113788 | 1113868 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 1516099 | 1516179 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 3 | 1473070 | 1473150 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 4 | 1757411 | 1757494 | - | NZ_LR134340.1 | Escherichia marmotae |
| 5 | 1123814 | 1123894 | - | NZ_AP014857.1 | Escherichia albertii |
| 6 | 1210987 | 1211058 | - | NC_013716.1 | Citrobacter rodentium ICC168 |
| 7 | 1872965 | 1873048 | + | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 8 | 2503570 | 2503650 | - | NZ_CP051548.1 | Phytobacter diazotrophicus |
| 9 | 1754979 | 1755068 | - | NZ_CP009756.1 | Enterobacter cloacae |
| 10 | 1240770 | 1240841 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF13091.8 | 0.89 | 8 | 5974 | opposite-strand | PLD-like domain |
| 2 | PF01757.24 | 1.0 | 9 | 4740.0 | same-strand | Acyltransferase family |
| 3 | PF04349.14 | 1.0 | 9 | 2872.0 | opposite-strand | Periplasmic glucan biosynthesis protein, MdoG |
| 4 | PF00535.28 | 1.0 | 9 | 343.5 | opposite-strand | Glycosyl transferase family 2 |
| 5 | PF13632.8 | 1.0 | 9 | 343.5 | opposite-strand | Glycosyl transferase family group 2 |
| 6 | PF13506.8 | 1.0 | 9 | 343.5 | opposite-strand | Glycosyl transferase family 21 |
| 7 | PF13984.8 | 1.0 | 9 | -61.0 | same-strand | MsyB protein |
| 8 | PF12832.9 | 0.89 | 8 | 396.0 | same-strand | MFS 1 like family |
| 9 | PF03279.15 | 0.89 | 8 | 1788 | same-strand | Bacterial lipid A biosynthesis acyltransferase |
| 10 | PF17773.3 | 0.89 | 8 | 2926 | opposite-strand | UPF0176 acylphosphatase like domain |
| 11 | PF12368.10 | 0.89 | 8 | 2926 | opposite-strand | Rhodanase C-terminal |
| 12 | PF00581.22 | 0.89 | 8 | 2926 | opposite-strand | Rhodanese-like domain |
| 13 | PF04264.15 | 0.78 | 7 | 4035.5 | same-strand | YceI-like domain |
++ More..