Result : EXP00256
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00256 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 4053664 |
| Right | 4053726 |
| Strand | - |
| Nucleotide Sequence | GTGGCGCAGTTGACAGCCACACACCGCAAACTGCCGTTGCTGCCGTGCTGTGTGCCGCAATGA |
| Sequence | VAQLTATHRKLPLLPCCVPQ |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 20 |
++ More..
| Conservation Analysis |
No. of Species: 6
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4053664 | 4053726 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 4066352 | 4066414 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 3 | 4387139 | 4387201 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 4 | 4849702 | 4849764 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 5 | 4281698 | 4281760 | + | NZ_LR134340.1 | Escherichia marmotae |
| 6 | 2997707 | 2997769 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 7 | 4024048 | 4024110 | - | NZ_AP014857.1 | Escherichia albertii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00476.22 | 0.83 | 5 | 3877.0 | opposite-strand | DNA polymerase family A |
| 2 | PF02739.18 | 0.83 | 5 | 3877.0 | opposite-strand | 5'-3' exonuclease, N-terminal resolvase-like domain |
| 3 | PF01612.22 | 0.83 | 5 | 3877.0 | opposite-strand | 3'-5' exonuclease |
| 4 | PF01367.22 | 0.83 | 5 | 3877.0 | opposite-strand | 5'-3' exonuclease, C-terminal SAM fold |
| 5 | PF01926.25 | 1.0 | 6 | 4568 | opposite-strand | 50S ribosome-binding GTPase |
| 6 | PF02421.20 | 0.83 | 5 | 2858.0 | same-strand | Ferrous iron transport protein B |
| 7 | PF04220.14 | 0.83 | 5 | 1769.0 | opposite-strand | Der GTPase activator (YihI) |
| 8 | PF04055.23 | 0.83 | 5 | 207.0 | opposite-strand | Radical SAM superfamily |
| 9 | PF06969.18 | 0.83 | 5 | 207.0 | opposite-strand | HemN C-terminal domain |
| 10 | PF00158.28 | 1.0 | 6 | 143 | same-strand | Sigma-54 interaction domain |
| 11 | PF00072.26 | 1.0 | 6 | 143 | same-strand | Response regulator receiver domain |
| 12 | PF14532.8 | 1.0 | 6 | 143 | same-strand | Sigma-54 interaction domain |
| 13 | PF02954.21 | 1.0 | 6 | 143 | same-strand | Bacterial regulatory protein, Fis family |
| 14 | PF07728.16 | 1.0 | 6 | 143 | same-strand | AAA domain (dynein-related subfamily) |
| 15 | PF02518.28 | 1.0 | 6 | 1564 | same-strand | Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase |
| 16 | PF00512.27 | 1.0 | 6 | 1564 | same-strand | His Kinase A (phospho-acceptor) domain |
| 17 | PF00989.27 | 1.0 | 6 | 1564 | same-strand | PAS fold |
| 18 | PF08448.12 | 0.83 | 5 | 1564.0 | same-strand | PAS fold |
| 19 | PF13426.9 | 0.83 | 5 | 1564.0 | same-strand | PAS domain |
| 20 | PF00120.26 | 1.0 | 6 | 2787 | same-strand | Glutamine synthetase, catalytic domain |
| 21 | PF03951.21 | 1.0 | 6 | 2787 | same-strand | Glutamine synthetase, beta-Grasp domain |
| 22 | PF00009.29 | 1.0 | 6 | 4569 | opposite-strand | Elongation factor Tu GTP binding domain |
| 23 | PF00679.26 | 1.0 | 6 | 4569 | opposite-strand | Elongation factor G C-terminus |
| 24 | PF03144.27 | 1.0 | 6 | 4569 | opposite-strand | Elongation factor Tu domain 2 |
++ More..