Result : EXP00255
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00255 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 2060957 |
| Right | 2060992 |
| Strand | - |
| Nucleotide Sequence | ATGCGGGTTTTTATTATTTGTTATGCCGGGCATTAG |
| Sequence | MRVFIICYAGH |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 11 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2060957 | 2060992 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 2078295 | 2078330 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 3 | 2609366 | 2609401 | - | NZ_LR134340.1 | Escherichia marmotae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF10423.11 | 0.67 | 2 | 3726.0 | opposite-strand | Bacterial AMP nucleoside phosphorylase N-terminus |
| 2 | PF01554.20 | 1.0 | 3 | 1300 | same-strand | MatE |
| 3 | PF03466.22 | 1.0 | 3 | 33.0 | same-strand | LysR substrate binding domain |
| 4 | PF00126.29 | 1.0 | 3 | 33.0 | same-strand | Bacterial regulatory helix-turn-helix protein, lysR family |
| 5 | PF17969.3 | 1.0 | 3 | 1399 | same-strand | L,D-transpeptidase C-terminal domain |
| 6 | PF03734.16 | 1.0 | 3 | 1399 | same-strand | L,D-transpeptidase catalytic domain |
| 7 | PF02277.19 | 1.0 | 3 | 2396 | same-strand | Phosphoribosyltransferase |
| 8 | PF02654.17 | 1.0 | 3 | 3489 | same-strand | Cobalamin-5-phosphate synthase |
| 9 | PF02283.18 | 1.0 | 3 | 4229 | same-strand | Cobinamide kinase / cobinamide phosphate guanyltransferase |
++ More..