Result : EXP00252
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00252 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 4171924 |
| Right | 4171992 |
| Strand | - |
| Nucleotide Sequence | ATGACGACAGGAAGAGTTTGTAGAAACGCAAAAAGGCCATCCGTCAGGATGGCCTTCTGCTTAATTTGA |
| Sequence | MTTGRVCRNAKRPSVRMAFCLI |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 22 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4171924 | 4171992 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 4191682 | 4191744 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 3 | 4144363 | 4144431 | - | NZ_AP014857.1 | Escherichia albertii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_004337.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF05958.13 | 1.0 | 3 | 8502 | same-strand | tRNA (Uracil-5-)-methyltransferase |
| 2 | PF00593.26 | 1.0 | 3 | 6286 | opposite-strand | TonB dependent receptor |
| 3 | PF07715.17 | 1.0 | 3 | 6286 | opposite-strand | TonB-dependent Receptor Plug Domain |
| 4 | PF01177.24 | 1.0 | 3 | 5484 | opposite-strand | Asp/Glu/Hydantoin racemase |
| 5 | PF02873.18 | 1.0 | 3 | 65 | opposite-strand | UDP-N-acetylenolpyruvoylglucosamine reductase, C-terminal domain |
| 6 | PF01565.25 | 1.0 | 3 | 65 | opposite-strand | FAD binding domain |
| 7 | PF03099.21 | 1.0 | 3 | 1090 | opposite-strand | Biotin/lipoate A/B protein ligase family |
| 8 | PF08279.14 | 1.0 | 3 | 1090 | opposite-strand | HTH domain |
| 9 | PF02237.19 | 1.0 | 3 | 1090 | opposite-strand | Biotin protein ligase C terminal domain |
| 10 | PF00009.29 | 1.0 | 3 | 3952 | opposite-strand | Elongation factor Tu GTP binding domain |
| 11 | PF03143.19 | 1.0 | 3 | 3952 | opposite-strand | Elongation factor Tu C-terminal domain |
| 12 | PF03144.27 | 1.0 | 3 | 3952 | opposite-strand | Elongation factor Tu domain 2 |
| 13 | PF01926.25 | 1.0 | 3 | 3952 | opposite-strand | 50S ribosome-binding GTPase |
| 14 | PF00584.22 | 1.0 | 3 | 5366 | opposite-strand | SecE/Sec61-gamma subunits of protein translocation complex |
| 15 | PF07226.13 | 0.67 | 2 | 9596.5 | opposite-strand | Protein of unknown function (DUF1422) |
++ More..