Result : EXP00251
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00251 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 1879185 |
| Right | 1879241 |
| Strand | - |
| Nucleotide Sequence | ATGGATTATTTTTGGGCTTATTGCCGGTATTCTGGCGAAGTGGATCATGCCAGGTAA |
| Sequence | MDYFWAYCRYSGEVDHAR |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 18 |
++ More..
| Conservation Analysis |
No. of Species: 14
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2480927 | 2480983 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 1879185 | 1879241 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 2054442 | 2054498 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 4 | 1965855 | 1965911 | + | NZ_LR134340.1 | Escherichia marmotae |
| 5 | 1358108 | 1358164 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
| 6 | 1726881 | 1726937 | - | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 7 | 3508243 | 3508299 | - | NZ_CP045205.1 | Citrobacter telavivensis |
| 8 | 3504362 | 3504418 | + | NZ_LT556085.1 | Citrobacter amalonaticus |
| 9 | 860452 | 860508 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 10 | 3160997 | 3161053 | + | NZ_CP007230.1 | Yersinia similis |
| 11 | 3093192 | 3093248 | - | NZ_LR134373.1 | Yersinia pseudotuberculosis |
| 12 | 2011062 | 2011118 | + | NC_013720.1 | Pirellula staleyi DSM 6068 |
| 13 | 4200796 | 4200852 | - | NZ_CP007044.2 | Chania multitudinisentens RB-25 |
| 14 | 2809931 | 2809987 | - | NC_017554.1 | Pantoea ananatis PA13 |
| 15 | 3015574 | 3015633 | - | NZ_CP072455.1 | Xenorhabdus budapestensis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF04226.15 | 1.0 | 14 | -56 | same-strand | Transglycosylase associated protein |
++ More..