Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00251 |
NCBI Accession ID | NC_000913.3 |
Organism | Escherichia coli str. K-12 substr. MG1655 |
Left | 1879185 |
Right | 1879241 |
Strand | - |
Nucleotide Sequence | ATGGATTATTTTTGGGCTTATTGCCGGTATTCTGGCGAAGTGGATCATGCCAGGTAA |
Sequence | MDYFWAYCRYSGEVDHAR |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 30904393 27013550 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 18 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 2480927 | 2480983 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
2 | 1879185 | 1879241 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
3 | 2054442 | 2054498 | + | NZ_CP061527.1 | Shigella dysenteriae |
4 | 1965855 | 1965911 | + | NZ_LR134340.1 | Escherichia marmotae |
5 | 1358108 | 1358164 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
6 | 1726881 | 1726937 | - | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
7 | 3508243 | 3508299 | - | NZ_CP045205.1 | Citrobacter telavivensis |
8 | 3504362 | 3504418 | + | NZ_LT556085.1 | Citrobacter amalonaticus |
9 | 860452 | 860508 | - | NZ_CP057657.1 | Escherichia fergusonii |
10 | 3160997 | 3161053 | + | NZ_CP007230.1 | Yersinia similis |
11 | 3093192 | 3093248 | - | NZ_LR134373.1 | Yersinia pseudotuberculosis |
12 | 2011062 | 2011118 | + | NC_013720.1 | Pirellula staleyi DSM 6068 |
13 | 4200796 | 4200852 | - | NZ_CP007044.2 | Chania multitudinisentens RB-25 |
14 | 2809931 | 2809987 | - | NC_017554.1 | Pantoea ananatis PA13 |
15 | 3015574 | 3015633 | - | NZ_CP072455.1 | Xenorhabdus budapestensis |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF04226.15 | 1.0 | 14 | -56 | same-strand | Transglycosylase associated protein |