Result : EXP00250
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00250 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 2413201 |
| Right | 2413269 |
| Strand | - |
| Nucleotide Sequence | ATGTACTACTTAGGCCTTCAGGCTGCTAAAGGATACCTGATAGTGGGTATGGAAGACAAAATGTTTTGA |
| Sequence | MYYLGLQAAKGYLIVGMEDKMF |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 22 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3139506 | 3139574 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 2413201 | 2413269 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 2421313 | 2421381 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 2951602 | 2951670 | - | NZ_LR134340.1 | Escherichia marmotae |
| 5 | 1312867 | 1312935 | + | NZ_CP061527.1 | Shigella dysenteriae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF12917.9 | 1.0 | 4 | 3740 | opposite-strand | HD containing hydrolase-like enzyme |
| 2 | PF13023.8 | 1.0 | 4 | 3740 | opposite-strand | HD domain |
| 3 | PF01966.24 | 1.0 | 4 | 3740 | opposite-strand | HD domain |
| 4 | PF02080.23 | 1.0 | 4 | 1849 | same-strand | TrkA-C domain |
| 5 | PF13419.8 | 1.0 | 4 | 1112 | same-strand | Haloacid dehalogenase-like hydrolase |
| 6 | PF00702.28 | 1.0 | 4 | 1112 | same-strand | haloacid dehalogenase-like hydrolase |
| 7 | PF03887.16 | 1.0 | 4 | 607 | same-strand | YfbU domain |
| 8 | PF04217.15 | 1.0 | 4 | 69 | same-strand | Protein of unknown function, DUF412 |
| 9 | PF00871.19 | 1.0 | 4 | 201 | opposite-strand | Acetokinase family |
| 10 | PF01515.21 | 1.0 | 4 | 1478 | opposite-strand | Phosphate acetyl/butaryl transferase |
| 11 | PF13500.8 | 1.0 | 4 | 1478 | opposite-strand | AAA domain |
| 12 | PF07085.14 | 1.0 | 4 | 1478 | opposite-strand | DRTGG domain |
| 13 | PF03606.17 | 1.0 | 4 | 3854 | opposite-strand | C4-dicarboxylate anaerobic carrier |
| 14 | PF00293.30 | 0.75 | 3 | 5365.0 | same-strand | NUDIX domain |
| 15 | PF12850.9 | 0.75 | 3 | 5965.0 | same-strand | Calcineurin-like phosphoesterase superfamily domain |
++ More..