Result : EXP00248
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00248 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 2942603 |
| Right | 2942647 |
| Strand | - |
| Nucleotide Sequence | ATGGCTCAGATTAAAAAAACTAATAGGTTACATAGTGTGATCTAA |
| Sequence | MAQIKKTNRLHSVI |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 14 |
++ More..
| Conservation Analysis |
No. of Species: 16
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3665130 | 3665174 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 2942603 | 2942647 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 2903037 | 2903081 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 808730 | 808774 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 3425989 | 3426033 | - | NZ_LR134340.1 | Escherichia marmotae |
| 6 | 5242065 | 5242109 | - | NZ_CP020388.1 | Pluralibacter gergoviae |
| 7 | 2866204 | 2866248 | - | NZ_AP014857.1 | Escherichia albertii |
| 8 | 858652 | 858696 | + | NZ_CP054058.1 | Scandinavium goeteborgense |
| 9 | 1554801 | 1554845 | + | NZ_CP045205.1 | Citrobacter telavivensis |
| 10 | 172124 | 172168 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
| 11 | 1730466 | 1730510 | - | NZ_CP033744.1 | Citrobacter freundii |
| 12 | 3877570 | 3877614 | - | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 13 | 3018045 | 3018089 | - | NC_013716.1 | Citrobacter rodentium ICC168 |
| 14 | 950999 | 951043 | - | NZ_CP053416.1 | Salmonella bongori |
| 15 | 3807704 | 3807748 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 16 | 3371146 | 3371190 | + | NZ_CP044098.1 | Citrobacter portucalensis |
| 17 | 4336059 | 4336103 | + | NZ_CP038469.1 | Citrobacter tructae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF05025.15 | 0.69 | 11 | 3293.0 | opposite-strand | RbsD / FucU transport protein family |
| 2 | PF00455.24 | 0.75 | 12 | 2504 | opposite-strand | DeoR C terminal sensor domain |
| 3 | PF08220.14 | 0.75 | 12 | 2504 | opposite-strand | DeoR-like helix-turn-helix domain |
| 4 | PF18125.3 | 1.0 | 16 | 1360 | same-strand | RlmM ferredoxin-like domain |
| 5 | PF04241.17 | 1.0 | 16 | 972 | same-strand | Protein of unknown function (DUF423) |
| 6 | PF03466.22 | 1.0 | 16 | 36 | same-strand | LysR substrate binding domain |
| 7 | PF00126.29 | 0.88 | 14 | 36 | same-strand | Bacterial regulatory helix-turn-helix protein, lysR family |
| 8 | PF06004.14 | 1.0 | 16 | 271 | same-strand | Bacterial protein of unknown function (DUF903) |
| 9 | PF00266.21 | 1.0 | 16 | 691 | opposite-strand | Aminotransferase class-V |
| 10 | PF02657.17 | 1.0 | 16 | 1896 | opposite-strand | Fe-S metabolism associated domain |
| 11 | PF00899.23 | 1.0 | 16 | 2389 | same-strand | ThiF family |
| 12 | PF06725.13 | 0.94 | 15 | 3351.0 | same-strand | 3D domain |
++ More..