Result : EXP00247
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00247 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 3793032 |
| Right | 3793073 |
| Strand | - |
| Nucleotide Sequence | TTGTTGGTTCACAGCATAAATGGAAAGAATTCTATAAATTAG |
| Sequence | LLVHSINGKNSIN |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 13 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4539990 | 4540031 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 3793032 | 3793073 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 3765503 | 3765544 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF04748.15 | 1.0 | 2 | 3972 | opposite-strand | Divergent polysaccharide deacetylase |
| 2 | PF08240.14 | 1.0 | 2 | 1687 | same-strand | Alcohol dehydrogenase GroES-like domain |
| 3 | PF00107.28 | 1.0 | 2 | 1687 | same-strand | Zinc-binding dehydrogenase |
| 4 | PF13602.8 | 1.0 | 2 | 1687 | same-strand | Zinc-binding dehydrogenase |
| 5 | PF00155.23 | 1.0 | 2 | 481 | same-strand | Aminotransferase class I and II |
| 6 | PF09612.12 | 1.0 | 2 | -41 | same-strand | Bacterial protein of unknown function (HtrL YibB) |
| 7 | PF01370.23 | 1.0 | 2 | 914 | opposite-strand | NAD dependent epimerase/dehydratase family |
| 8 | PF16363.7 | 1.0 | 2 | 914 | opposite-strand | GDP-mannose 4,6 dehydratase |
| 9 | PF01073.21 | 1.0 | 2 | 914 | opposite-strand | 3-beta hydroxysteroid dehydrogenase/isomerase family |
| 10 | PF01075.19 | 1.0 | 2 | 2381.0 | opposite-strand | Glycosyltransferase family 9 (heptosyltransferase) |
| 11 | PF04932.17 | 1.0 | 2 | 3895.0 | opposite-strand | O-Antigen ligase |
| 12 | PF00534.22 | 1.0 | 2 | 5139.0 | same-strand | Glycosyl transferases group 1 |
| 13 | PF13692.8 | 1.0 | 2 | 5139.0 | same-strand | Glycosyl transferases group 1 |
| 14 | PF13524.8 | 1.0 | 2 | 5139.0 | same-strand | Glycosyl transferases group 1 |
++ More..