Result : EXP00245

Protein Information

• Protein name: EXP00245
• NCBI Accession ID: NC_000913.3
• Organism: Escherichia coli str. K-12 substr. MG1655
• Left: 407176
• Right: 407235
• Strand: -
• Nucleotide Sequence: ATGAAAAATGTGACGCAGATCCCTTGTAGTGGCACTCAGAATCCCTTCCGAGCAGTCTGA
• Sequence: MKNVTQIPCSGTQNPFRAV
• Source of smORF: Ribo-seq
• Pubmed ID: 30904393 27013550
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 19

Conservation Analysis

No. of Species: 2

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	466956	467015	-	NC_002695.2	Escherichia coli O157:H7 str. Sakai
2	407176	407235	-	NC_000913.3	Escherichia coli str. K-12 substr. MG1655
3	336419	336478	-	NC_004337.2	Shigella flexneri 2a str. 301

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_000913.3

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF00990.23	1.0	2	2358	opposite-strand	Diguanylate cyclase, GGDEF domain
2	PF05230.13	1.0	2	2358	opposite-strand	MASE2 domain
3	PF14748.8	1.0	2	1532	same-strand	Pyrroline-5-carboxylate reductase dimerisation
4	PF03807.19	1.0	2	1532	same-strand	NADP oxidoreductase coenzyme F420-dependent
5	PF02639.16	1.0	2	954	opposite-strand	Uncharacterized BCR, YaiI/YqxD family COG1671
6	PF01202.24	1.0	2	247	opposite-strand	Shikimate kinase
7	PF13238.8	1.0	2	247	opposite-strand	AAA domain
8	PF16362.7	1.0	2	6	opposite-strand	YaiA protein
9	PF07302.13	1.0	2	193	opposite-strand	AroM protein
10	PF06865.13	1.0	2	942	opposite-strand	Pyrimidine/purine nucleoside phosphorylase
11	PF04381.14	1.0	2	2246	same-strand	Putative exonuclease, RdgC
12	PF00480.22	1.0	2	3095.5	opposite-strand	ROK family