Result : EXP00235
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00235 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 2413136 |
| Right | 2413204 |
| Strand | - |
| Nucleotide Sequence | TTGAACGTTGTCCCGCTGAGTTGTGAATTTGCACAAATTTTTGAATCTTTATATGTGAAGTTGAGGTGA |
| Sequence | LNVVPLSCEFAQIFESLYVKLR |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 22 |
++ More..
| Conservation Analysis |
No. of Species: 13
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3139441 | 3139509 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 2413136 | 2413204 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 2421248 | 2421316 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 1312932 | 1313000 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 2951537 | 2951605 | - | NZ_LR134340.1 | Escherichia marmotae |
| 6 | 2409685 | 2409753 | - | NZ_AP014857.1 | Escherichia albertii |
| 7 | 4636924 | 4636992 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
| 8 | 2206711 | 2206779 | + | NZ_CP045205.1 | Citrobacter telavivensis |
| 9 | 4389143 | 4389211 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 10 | 2849517 | 2849585 | - | NC_013716.1 | Citrobacter rodentium ICC168 |
| 11 | 476718 | 476786 | + | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 12 | 3194171 | 3194239 | - | NZ_CP012871.1 | [Enterobacter] lignolyticus |
| 13 | 640919 | 640975 | + | NZ_CP022356.1 | Paraphotobacterium marinum |
| 14 | 1302150 | 1302218 | + | NZ_CP054058.1 | Scandinavium goeteborgense |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF12917.9 | 0.92 | 12 | 3675 | opposite-strand | HD containing hydrolase-like enzyme |
| 2 | PF13023.8 | 0.92 | 12 | 3675 | opposite-strand | HD domain |
| 3 | PF01966.24 | 0.92 | 12 | 3675 | opposite-strand | HD domain |
| 4 | PF02080.23 | 0.92 | 12 | 1784 | same-strand | TrkA-C domain |
| 5 | PF13419.8 | 0.92 | 12 | 1048 | same-strand | Haloacid dehalogenase-like hydrolase |
| 6 | PF00702.28 | 0.92 | 12 | 1048 | same-strand | haloacid dehalogenase-like hydrolase |
| 7 | PF03887.16 | 0.92 | 12 | 543 | same-strand | YfbU domain |
| 8 | PF04217.15 | 0.92 | 12 | 4 | same-strand | Protein of unknown function, DUF412 |
| 9 | PF00871.19 | 0.92 | 12 | 266 | opposite-strand | Acetokinase family |
| 10 | PF01515.21 | 0.92 | 12 | 1544 | opposite-strand | Phosphate acetyl/butaryl transferase |
| 11 | PF13500.8 | 0.92 | 12 | 1544 | opposite-strand | AAA domain |
| 12 | PF07085.14 | 0.92 | 12 | 1544 | opposite-strand | DRTGG domain |
| 13 | PF03606.17 | 0.69 | 9 | 3901.5 | opposite-strand | C4-dicarboxylate anaerobic carrier |
++ More..