Result : EXP00233
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00233 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 491079 |
| Right | 491132 |
| Strand | - |
| Nucleotide Sequence | GTGAGCAAAATAAGCAAAATCGCCCGCGGTTTGACGCCGCGCGGCATCGCATGA |
| Sequence | VSKISKIARGLTPRGIA |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 17 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 556975 | 557028 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 491079 | 491132 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 427610 | 427663 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 3171251 | 3171304 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 509079 | 509132 | - | NZ_AP014857.1 | Escherichia albertii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF08361.13 | 1.0 | 4 | 4663 | opposite-strand | MAATS-type transcriptional repressor, C-terminal region |
| 2 | PF00440.25 | 1.0 | 4 | 4663 | opposite-strand | Bacterial regulatory proteins, tetR family |
| 3 | PF12794.9 | 1.0 | 4 | 1179 | opposite-strand | Mechanosensitive ion channel inner membrane domain 1 |
| 4 | PF12795.9 | 1.0 | 4 | 1179 | opposite-strand | Mechanosensitive ion channel porin domain |
| 5 | PF00924.20 | 1.0 | 4 | 1179 | opposite-strand | Mechanosensitive ion channel |
| 6 | PF10689.11 | 1.0 | 4 | 808 | same-strand | Protein of unknown function (DUF2496) |
| 7 | PF07445.14 | 1.0 | 4 | 267 | same-strand | Primosomal replication protein priC |
| 8 | PF04304.15 | 1.0 | 4 | -53 | opposite-strand | Protein of unknown function (DUF454) |
| 9 | PF12170.10 | 1.0 | 4 | 960 | opposite-strand | DNA polymerase III tau subunit V interacting with alpha |
| 10 | PF13177.8 | 1.0 | 4 | 960 | opposite-strand | DNA polymerase III, delta subunit |
| 11 | PF12169.10 | 1.0 | 4 | 960 | opposite-strand | DNA polymerase III subunits gamma and tau domain III |
| 12 | PF12168.10 | 1.0 | 4 | 960 | opposite-strand | DNA polymerase III subunits tau domain IV DnaB-binding |
| 13 | PF00004.31 | 1.0 | 4 | 960 | opposite-strand | ATPase family associated with various cellular activities (AAA) |
| 14 | PF13401.8 | 1.0 | 4 | 960 | opposite-strand | AAA domain |
| 15 | PF02575.18 | 1.0 | 4 | 2944 | opposite-strand | YbaB/EbfC DNA-binding family |
| 16 | PF13662.8 | 1.0 | 4 | 3273 | opposite-strand | Toprim domain |
| 17 | PF02132.17 | 1.0 | 4 | 3273 | opposite-strand | RecR protein |
| 18 | PF01751.24 | 1.0 | 4 | 3273 | opposite-strand | Toprim domain |
| 19 | PF00183.20 | 1.0 | 4 | 3988 | opposite-strand | Hsp90 protein |
| 20 | PF02518.28 | 1.0 | 4 | 3988 | opposite-strand | Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase |
| 21 | PF13589.8 | 1.0 | 4 | 3988 | opposite-strand | Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase |
++ More..