Result : EXP00231

Protein Information

• Protein name: EXP00231
• NCBI Accession ID: NC_000913.3
• Organism: Escherichia coli str. K-12 substr. MG1655
• Left: 2987069
• Right: 2987140
• Strand: -
• Nucleotide Sequence: ATGAATATTATGAAAAATGGAATGGTTCAAAATTGTAGCAATTTTGAACCATCCACAACTGATATTAGCTAA
• Sequence: MNIMKNGMVQNCSNFEPSTTDIS
• Source of smORF: Ribo-seq
• Pubmed ID: 30904393 27013550
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 23

Conservation Analysis

No. of Species: 2

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	2987069	2987140	-	NC_000913.3	Escherichia coli str. K-12 substr. MG1655
2	2947429	2947500	-	NC_004337.2	Shigella flexneri 2a str. 301
3	3709597	3709668	-	NC_002695.2	Escherichia coli O157:H7 str. Sakai

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_000913.3

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF00083.26	1.0	2	4887	same-strand	Sugar (and other) transporter
2	PF07690.18	1.0	2	4887	same-strand	Major Facilitator Superfamily
3	PF13561.8	1.0	2	3811	same-strand	Enoyl-(Acyl carrier protein) reductase
4	PF00106.27	1.0	2	3811	same-strand	short chain dehydrogenase
5	PF04962.14	1.0	2	2945	same-strand	KduI/IolB family
6	PF00108.25	1.0	2	1477	same-strand	Thiolase, N-terminal domain
7	PF02803.20	1.0	2	1477	same-strand	Thiolase, C-terminal domain