Result : EXP00230
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00230 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 2601014 |
| Right | 2601079 |
| Strand | - |
| Nucleotide Sequence | ATGGTCATTAACGTTCAGCAAAAAATGGATTCGACACCCGTGTCGCAGGGGAAAGCGAGAATGTGA |
| Sequence | MVINVQQKMDSTPVSQGKARM |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 21 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2601014 | 2601079 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 2589071 | 2589136 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 3 | 1147038 | 1147103 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 4 | 3317244 | 3317309 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF06804.13 | 1.0 | 3 | 2149.0 | same-strand | NlpB/DapX lipoprotein |
| 2 | PF00701.24 | 1.0 | 3 | 1254.0 | same-strand | Dihydrodipicolinate synthetase family |
| 3 | PF13740.8 | 1.0 | 3 | 536.0 | opposite-strand | ACT domain |
| 4 | PF01842.27 | 1.0 | 3 | 536.0 | opposite-strand | ACT domain |
| 5 | PF00578.23 | 1.0 | 3 | 66.0 | opposite-strand | AhpC/TSA family |
| 6 | PF08534.12 | 1.0 | 3 | 66.0 | opposite-strand | Redoxin |
| 7 | PF02630.16 | 1.0 | 3 | 66.0 | opposite-strand | SCO1/SenC |
| 8 | PF12838.9 | 1.0 | 3 | 122.0 | opposite-strand | 4Fe-4S dicluster domain |
| 9 | PF00037.29 | 1.0 | 3 | 122.0 | opposite-strand | 4Fe-4S binding domain |
| 10 | PF13187.8 | 1.0 | 3 | 122.0 | opposite-strand | 4Fe-4S dicluster domain |
| 11 | PF12837.9 | 1.0 | 3 | 122.0 | opposite-strand | 4Fe-4S binding domain |
| 12 | PF13237.8 | 1.0 | 3 | 122.0 | opposite-strand | 4Fe-4S dicluster domain |
| 13 | PF14697.8 | 1.0 | 3 | 122.0 | opposite-strand | 4Fe-4S dicluster domain |
| 14 | PF12797.9 | 1.0 | 3 | 122.0 | opposite-strand | 4Fe-4S binding domain |
| 15 | PF00361.22 | 1.0 | 3 | 2235.0 | opposite-strand | Proton-conducting membrane transporter |
| 16 | PF00146.23 | 1.0 | 3 | 2768.0 | opposite-strand | NADH dehydrogenase |
| 17 | PF00662.22 | 1.0 | 3 | 3732.0 | opposite-strand | NADH-Ubiquinone oxidoreductase (complex I), chain 5 N-terminus |
++ More..