Result : EXP00229
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00229 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 1936437 |
| Right | 1936493 |
| Strand | - |
| Nucleotide Sequence | ATGGAAAACGATGATTTTTTTATCAGTTTTGCCGCACTTTGCGCGCTTTTCCCGTAA |
| Sequence | MENDDFFISFAALCALFP |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 18 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1936437 | 1936493 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 1900310 | 1900366 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 3 | 2538405 | 2538461 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 4 | 2508086 | 2508142 | - | NZ_CP061527.1 | Shigella dysenteriae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF07130.14 | 0.67 | 2 | 5690 | same-strand | YebG protein |
| 2 | PF02222.24 | 1.0 | 3 | 4378.0 | opposite-strand | ATP-grasp domain |
| 3 | PF02655.16 | 1.0 | 3 | 4378.0 | opposite-strand | ATP-grasp domain |
| 4 | PF01081.21 | 1.0 | 3 | 3681.0 | same-strand | KDPG and KHG aldolase |
| 5 | PF00920.23 | 1.0 | 3 | 1833.0 | same-strand | Dehydratase family |
| 6 | PF02781.18 | 1.0 | 3 | 123.0 | same-strand | Glucose-6-phosphate dehydrogenase, C-terminal domain |
| 7 | PF00479.24 | 1.0 | 3 | 123.0 | same-strand | Glucose-6-phosphate dehydrogenase, NAD binding domain |
| 8 | PF01418.19 | 1.0 | 3 | 159.0 | opposite-strand | Helix-turn-helix domain, rpiR family |
| 9 | PF01380.24 | 1.0 | 3 | 159.0 | opposite-strand | SIS domain |
| 10 | PF00224.23 | 1.0 | 3 | 1156.0 | opposite-strand | Pyruvate kinase, barrel domain |
| 11 | PF02887.18 | 1.0 | 3 | 1156.0 | opposite-strand | Pyruvate kinase, alpha/beta domain |
| 12 | PF03279.15 | 1.0 | 3 | 2729.0 | same-strand | Bacterial lipid A biosynthesis acyltransferase |
| 13 | PF19425.1 | 0.67 | 2 | 3820 | same-strand | Csd3 second domain |
| 14 | PF01551.24 | 0.67 | 2 | 3820 | same-strand | Peptidase family M23 |
| 15 | PF04225.14 | 0.67 | 2 | 3820 | same-strand | Opacity-associated protein A LysM-like domain |
| 16 | PF08525.13 | 0.67 | 2 | 3820 | same-strand | Opacity-associated protein A N-terminal motif |
| 17 | PF01476.22 | 0.67 | 2 | 3820 | same-strand | LysM domain |
++ More..