Result : EXP00228
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00228 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 1842220 |
| Right | 1842261 |
| Strand | - |
| Nucleotide Sequence | ATGACCCAGGAAAGCAAATTAATAACGAGAGTAATCTCATAA |
| Sequence | MTQESKLITRVIS |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 13 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2441869 | 2441910 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 1842220 | 1842261 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 1501827 | 1501868 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 2217217 | 2217258 | - | NZ_CP061527.1 | Shigella dysenteriae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00581.22 | 1.0 | 3 | 1446.0 | opposite-strand | Rhodanese-like domain |
| 2 | PF01066.23 | 1.0 | 3 | 817.0 | same-strand | CDP-alcohol phosphatidyltransferase |
| 3 | PF00293.30 | 1.0 | 3 | 323.0 | opposite-strand | NUDIX domain |
| 4 | PF14815.8 | 1.0 | 3 | 323.0 | opposite-strand | NUDIX domain |
| 5 | PF07383.14 | 1.0 | 3 | 85.0 | same-strand | Protein of unknown function (DUF1496) |
| 6 | PF00208.23 | 1.0 | 3 | 110.0 | opposite-strand | Glutamate/Leucine/Phenylalanine/Valine dehydrogenase |
| 7 | PF02812.20 | 1.0 | 3 | 110.0 | opposite-strand | Glu/Leu/Phe/Val dehydrogenase, dimerisation domain |
| 8 | PF06889.13 | 1.0 | 3 | 1570.0 | same-strand | Protein of unknown function (DUF1266) |
| 9 | PF01131.22 | 0.67 | 2 | 2738 | same-strand | DNA topoisomerase |
| 10 | PF01751.24 | 0.67 | 2 | 2738 | same-strand | Toprim domain |
++ More..