Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00227 |
NCBI Accession ID | NC_000913.3 |
Organism | Escherichia coli str. K-12 substr. MG1655 |
Left | 1734183 |
Right | 1734224 |
Strand | - |
Nucleotide Sequence | ATGCAACAAATAGAGCAAAGGGATAAAATAGCAAAAGCGTGA |
Sequence | MQQIEQRDKIAKA |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 30904393 27013550 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 13 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 1734183 | 1734224 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
2 | 2334046 | 2334087 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
3 | 1713875 | 1713916 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
4 | 2079072 | 2079113 | + | NZ_LR134340.1 | Escherichia marmotae |
5 | 1888507 | 1888548 | + | NZ_CP061527.1 | Shigella dysenteriae |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00929.26 | 0.75 | 3 | 5189.0 | opposite-strand | Exonuclease |
2 | PF16473.7 | 0.75 | 3 | 5189.0 | opposite-strand | 3' exoribonuclease, RNase T-like |
3 | PF00462.26 | 1.0 | 4 | 82 | same-strand | Glutaredoxin |
4 | PF00877.21 | 1.0 | 4 | 212 | opposite-strand | NlpC/P60 family |
5 | PF02777.20 | 1.0 | 4 | 1166 | opposite-strand | Iron/manganese superoxide dismutases, C-terminal domain |
6 | PF00081.24 | 1.0 | 4 | 1166 | opposite-strand | Iron/manganese superoxide dismutases, alpha-hairpin domain |
7 | PF07690.18 | 1.0 | 4 | 1894 | same-strand | Major Facilitator Superfamily |
8 | PF06779.16 | 1.0 | 4 | 1894 | same-strand | Uncharacterised MFS-type transporter YbfB |
9 | PF13377.8 | 0.75 | 3 | 3617.0 | opposite-strand | Periplasmic binding protein-like domain |
10 | PF00532.23 | 1.0 | 4 | 3617 | opposite-strand | Periplasmic binding proteins and sugar binding domain of LacI family |
11 | PF13407.8 | 1.0 | 4 | 3617 | opposite-strand | Periplasmic binding protein domain |
12 | PF00356.23 | 1.0 | 4 | 3617 | opposite-strand | Bacterial regulatory proteins, lacI family |