Result : EXP00224
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00224 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 3101726 |
| Right | 3101791 |
| Strand | - |
| Nucleotide Sequence | ATGACAAATGCAAAACTGCCTGATGCGCTACGCTTATCAGGCCTGGAAAGATGCACGATCGAGTAG |
| Sequence | MTNAKLPDALRLSGLERCTIE |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 21 |
++ More..
| Conservation Analysis |
No. of Species: 6
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3101726 | 3101791 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 610100 | 610165 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 3043824 | 3043889 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 512825 | 512890 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 5 | 720170 | 720235 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 6 | 3119766 | 3119831 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 7 | 2842449 | 2842514 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 8 | 3042719 | 3042784 | - | NZ_AP014857.1 | Escherichia albertii |
| 9 | 3314080 | 3314145 | - | NZ_AP014857.1 | Escherichia albertii |
| 10 | 3468236 | 3468301 | + | NZ_AP014857.1 | Escherichia albertii |
| 11 | 584022 | 584087 | + | NZ_AP014857.1 | Escherichia albertii |
| 12 | 3018018 | 3018083 | + | NZ_AP014857.1 | Escherichia albertii |
| 13 | 3843447 | 3843512 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 14 | 691757 | 691822 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 15 | 937935 | 938000 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 16 | 3083483 | 3083554 | - | NZ_LR134340.1 | Escherichia marmotae |
| 17 | 1483567 | 1483632 | - | NZ_LR134340.1 | Escherichia marmotae |
| 18 | 2456046 | 2456102 | - | NZ_LR134340.1 | Escherichia marmotae |
| 19 | 162359 | 162427 | - | NZ_LR134340.1 | Escherichia marmotae |
| 20 | 4281208 | 4281279 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 21 | 1563157 | 1563222 | - | NZ_CP057657.1 | Escherichia fergusonii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF06717.13 | 0.67 | 4 | 2161 | same-strand | Protein of unknown function (DUF1202) |
| 2 | PF00710.22 | 0.67 | 4 | 998 | same-strand | Asparaginase, N-terminal |
| 3 | PF17763.3 | 0.67 | 4 | 998 | same-strand | Glutaminase/Asparaginase C-terminal domain |
| 4 | PF11101.10 | 0.67 | 4 | 103 | same-strand | Protein of unknown function (DUF2884) |
| 5 | PF04320.16 | 0.67 | 4 | 16 | same-strand | YggL 50S ribosome-binding protein |
| 6 | PF02390.19 | 0.67 | 4 | 342 | same-strand | Putative methyltransferase |
| 7 | PF14815.8 | 0.67 | 4 | 1222 | opposite-strand | NUDIX domain |
| 8 | PF00730.27 | 0.67 | 4 | 1222 | opposite-strand | HhH-GPD superfamily base excision DNA repair protein |
| 9 | PF00633.25 | 0.67 | 4 | 1222 | opposite-strand | Helix-hairpin-helix motif |
| 10 | PF10576.11 | 0.67 | 4 | 1222 | opposite-strand | Iron-sulfur binding domain of endonuclease III |
| 11 | PF04362.16 | 0.67 | 4 | 2302 | opposite-strand | Bacterial Fe(2+) trafficking |
| 12 | PF11873.10 | 0.67 | 4 | 2642 | opposite-strand | Membrane-bound lytic murein transglycosylase C, N-terminal domain |
| 13 | PF01464.22 | 0.67 | 4 | 2642 | opposite-strand | Transglycosylase SLT domain |
| 14 | PF01848.18 | 0.67 | 4 | 763 | same-strand | Hok/gef family |
| 15 | PF17837.3 | 0.83 | 5 | -47.5 | opposite-strand | 4'-phosphopantetheinyl transferase N-terminal domain |
| 16 | PF01648.22 | 0.67 | 4 | -30 | opposite-strand | 4'-phosphopantetheinyl transferase superfamily |
| 17 | PF00593.26 | 1.0 | 6 | 89 | opposite-strand | TonB dependent receptor |
| 18 | PF07715.17 | 1.0 | 6 | 89 | opposite-strand | TonB-dependent Receptor Plug Domain |
| 19 | PF00756.22 | 0.83 | 5 | 2572.0 | same-strand | Putative esterase |
| 20 | PF11806.10 | 0.83 | 5 | 2572.0 | same-strand | Domain of unknown function (DUF3327) |
| 21 | PF03621.15 | 0.67 | 4 | 3777 | same-strand | MbtH-like protein |
| 22 | PF00668.22 | 0.83 | 5 | 3992.0 | same-strand | Condensation domain |
| 23 | PF00501.30 | 0.83 | 5 | 3992.0 | same-strand | AMP-binding enzyme |
| 24 | PF00975.22 | 0.83 | 5 | 3992.0 | same-strand | Thioesterase domain |
| 25 | PF00550.27 | 0.83 | 5 | 3992.0 | same-strand | Phosphopantetheine attachment site |
| 26 | PF13193.8 | 0.83 | 5 | 3992.0 | same-strand | AMP-binding enzyme C-terminal domain |
++ More..