Result : EXP00222
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00222 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 754715 |
| Right | 754768 |
| Strand | - |
| Nucleotide Sequence | ATGAAGTCGGTATTTCACCTAAGATTAACTTATGTAACAGTGTGGAAGTATTGA |
| Sequence | MKSVFHLRLTYVTVWKY |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 17 |
++ More..
| Conservation Analysis |
No. of Species: 16
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 831361 | 831414 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 754715 | 754768 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 602285 | 602338 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 2992226 | 2992279 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 1385369 | 1385422 | - | NZ_LR134340.1 | Escherichia marmotae |
| 6 | 4267668 | 4267721 | - | NZ_CP033744.1 | Citrobacter freundii |
| 7 | 845879 | 845932 | + | NZ_CP044098.1 | Citrobacter portucalensis |
| 8 | 1381441 | 1381494 | - | NZ_CP012266.1 | Cronobacter dublinensis subsp. dublinensis LMG 23823 |
| 9 | 1337231 | 1337284 | - | NZ_CP012257.1 | Cronobacter universalis NCTC 9529 |
| 10 | 2086889 | 2086942 | + | NZ_CP027107.1 | Cronobacter sakazakii |
| 11 | 2256063 | 2256116 | + | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 12 | 3904907 | 3904960 | + | NZ_CP054254.1 | Klebsiella variicola |
| 13 | 1628498 | 1628551 | - | NC_016845.1 | Klebsiella pneumoniae subsp. pneumoniae HS11286 |
| 14 | 3648703 | 3648756 | + | NZ_CP065838.1 | Klebsiella quasipneumoniae |
| 15 | 2708833 | 2708886 | + | NZ_CP012268.1 | Cronobacter muytjensii ATCC 51329 |
| 16 | 1337059 | 1337112 | - | NZ_CP012264.1 | Cronobacter condimenti 1330 |
| 17 | 3281598 | 3281651 | - | NZ_CP053416.1 | Salmonella bongori |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP044098.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00285.23 | 1.0 | 16 | 247 | same-strand | Citrate synthase, C-terminal domain |
| 2 | PF01127.24 | 1.0 | 16 | 409 | opposite-strand | Succinate dehydrogenase/Fumarate reductase transmembrane subunit |
| 3 | PF00890.26 | 1.0 | 16 | 1141 | opposite-strand | FAD binding domain |
| 4 | PF02910.22 | 1.0 | 16 | 1141 | opposite-strand | Fumarate reductase flavoprotein C-term |
| 5 | PF13085.8 | 1.0 | 16 | 2921 | opposite-strand | 2Fe-2S iron-sulfur cluster binding domain |
| 6 | PF13534.8 | 1.0 | 16 | 2921 | opposite-strand | 4Fe-4S dicluster domain |
| 7 | PF13183.8 | 1.0 | 16 | 2921 | opposite-strand | 4Fe-4S dicluster domain |
| 8 | PF13237.8 | 1.0 | 16 | 2921 | opposite-strand | 4Fe-4S dicluster domain |
| 9 | PF02779.26 | 0.94 | 15 | 3950.0 | opposite-strand | Transketolase, pyrimidine binding domain |
| 10 | PF16870.7 | 0.94 | 15 | 3950.0 | opposite-strand | 2-oxoglutarate dehydrogenase C-terminal |
| 11 | PF00676.22 | 0.94 | 15 | 3950.0 | opposite-strand | Dehydrogenase E1 component |
| 12 | PF16078.7 | 0.94 | 15 | 3950.0 | opposite-strand | 2-oxoglutarate dehydrogenase N-terminus |
| 13 | PF06831.16 | 0.62 | 10 | 1706.5 | opposite-strand | Formamidopyrimidine-DNA glycosylase H2TH domain |
| 14 | PF01149.26 | 0.62 | 10 | 1706.5 | opposite-strand | Formamidopyrimidine-DNA glycosylase N-terminal domain |
| 15 | PF06827.16 | 0.62 | 10 | 1706.5 | opposite-strand | Zinc finger found in FPG and IleRS |
++ More..