Result : EXP00217
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00217 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 2533391 |
| Right | 2533444 |
| Strand | - |
| Nucleotide Sequence | TTGAAGCAGGCCACAAAAAAGCACCTAAAAAGGTGCTTTTTTACGCATTTTTAA |
| Sequence | LKQATKKHLKRCFFTHF |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 17 |
++ More..
| Conservation Analysis |
No. of Species: 28
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3257917 | 3257970 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 2533391 | 2533444 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 2530691 | 2530744 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 1200803 | 1200856 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 515489 | 515542 | - | NZ_CP053416.1 | Salmonella bongori |
| 6 | 2030652 | 2030705 | + | NZ_CP045205.1 | Citrobacter telavivensis |
| 7 | 2495822 | 2495875 | - | NC_013716.1 | Citrobacter rodentium ICC168 |
| 8 | 4764911 | 4764964 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
| 9 | 4286430 | 4286483 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 10 | 3681941 | 3681994 | - | NZ_CP043318.1 | Enterobacter chengduensis |
| 11 | 3471813 | 3471866 | - | NZ_CP009756.1 | Enterobacter cloacae |
| 12 | 3896540 | 3896593 | + | NZ_CP025034.2 | Enterobacter sp. SGAir0187 |
| 13 | 3390750 | 3390803 | - | NZ_CP017184.1 | Enterobacter roggenkampii |
| 14 | 3361192 | 3361245 | - | NZ_CP027986.1 | Enterobacter sichuanensis |
| 15 | 2507510 | 2507563 | - | NZ_AP014857.1 | Escherichia albertii |
| 16 | 2544212 | 2544265 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 17 | 1102490 | 1102543 | - | NZ_AP019007.1 | Enterobacter oligotrophicus |
| 18 | 2648005 | 2648058 | - | NZ_CP017279.1 | Enterobacter ludwigii |
| 19 | 3356207 | 3356260 | - | NZ_AP022508.1 | Enterobacter bugandensis |
| 20 | 3364303 | 3364356 | - | NC_015968.1 | Enterobacter soli |
| 21 | 155140 | 155193 | + | NZ_CP045769.1 | Enterobacter cancerogenus |
| 22 | 3876034 | 3876087 | + | NZ_CP044098.1 | Citrobacter portucalensis |
| 23 | 4818680 | 4818733 | + | NZ_CP038469.1 | Citrobacter tructae |
| 24 | 362989 | 363042 | + | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 25 | 2950987 | 2951040 | + | NZ_CP042941.1 | Atlantibacter hermannii |
| 26 | 1647948 | 1648001 | + | NZ_CP036175.1 | Klebsiella huaxiensis |
| 27 | 1389642 | 1389695 | + | NZ_CP041247.1 | Raoultella electrica |
| 28 | 1224348 | 1224401 | - | NZ_CP033744.1 | Citrobacter freundii |
| 29 | 4834916 | 4834969 | + | NZ_CP067057.1 | Rahnella aceris |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF12843.9 | 0.96 | 27 | 5222.0 | same-strand | Putative quorum-sensing-regulated virulence factor |
| 2 | PF01653.20 | 0.96 | 27 | 3216.0 | same-strand | NAD-dependent DNA ligase adenylation domain |
| 3 | PF03120.18 | 0.96 | 27 | 3216.0 | same-strand | NAD-dependent DNA ligase OB-fold domain |
| 4 | PF12826.9 | 1.0 | 28 | 3217 | same-strand | Helix-hairpin-helix motif |
| 5 | PF14520.8 | 1.0 | 28 | 3217 | same-strand | Helix-hairpin-helix domain |
| 6 | PF00533.28 | 1.0 | 28 | 3217 | same-strand | BRCA1 C Terminus (BRCT) domain |
| 7 | PF03119.18 | 0.96 | 27 | 3216.0 | same-strand | NAD-dependent DNA ligase C4 zinc finger domain |
| 8 | PF12738.9 | 0.96 | 27 | 3216.0 | same-strand | twin BRCT domain |
| 9 | PF00633.25 | 0.93 | 26 | 3217 | same-strand | Helix-hairpin-helix motif |
| 10 | PF04354.15 | 1.0 | 28 | 2138 | same-strand | ZipA, C-terminal FtsZ-binding domain |
| 11 | PF07264.13 | 1.0 | 28 | 1146 | opposite-strand | Etoposide-induced protein 2.4 (EI24) |
| 12 | PF00291.27 | 1.0 | 28 | 11 | opposite-strand | Pyridoxal-phosphate dependent enzyme |
| 13 | PF00381.21 | 1.0 | 28 | 318 | opposite-strand | PTS HPr component phosphorylation site |
| 14 | PF02896.20 | 1.0 | 28 | 622 | opposite-strand | PEP-utilising enzyme, PEP-binding domain |
| 15 | PF05524.15 | 1.0 | 28 | 622 | opposite-strand | PEP-utilising enzyme, N-terminal |
| 16 | PF00391.25 | 1.0 | 28 | 622 | opposite-strand | PEP-utilising enzyme, mobile domain |
| 17 | PF00358.22 | 1.0 | 28 | 2390 | opposite-strand | phosphoenolpyruvate-dependent sugar phosphotransferase system, EIIA 1 |
++ More..