Result : EXP00216
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00216 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 1948686 |
| Right | 1948748 |
| Strand | - |
| Nucleotide Sequence | ATGACTCAAATACACGAAATCATTCGCGTTGCATCGAGGCGGCAACTGAGTGAACTCCCATGA |
| Sequence | MTQIHEIIRVASRRQLSELP |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 20 |
++ More..
| Conservation Analysis |
No. of Species: 16
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2550753 | 2550815 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 1948686 | 1948748 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 1912557 | 1912619 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 2520334 | 2520396 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 2749840 | 2749902 | + | NZ_CP045205.1 | Citrobacter telavivensis |
| 6 | 2515895 | 2515957 | - | NZ_LR134340.1 | Escherichia marmotae |
| 7 | 1889566 | 1889628 | - | NZ_AP014857.1 | Escherichia albertii |
| 8 | 187897 | 187962 | - | NZ_CP036175.1 | Klebsiella huaxiensis |
| 9 | 4192782 | 4192844 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
| 10 | 1098466 | 1098528 | - | NZ_CP040428.1 | Jejubacter calystegiae |
| 11 | 2576669 | 2576740 | - | NZ_CP026047.1 | Raoultella planticola |
| 12 | 2586922 | 2586990 | - | NZ_CP011602.1 | Phytobacter ursingii |
| 13 | 4655563 | 4655634 | + | NZ_CP046672.1 | Raoultella ornithinolytica |
| 14 | 2477755 | 2477820 | - | NZ_CP038469.1 | Citrobacter tructae |
| 15 | 195244 | 195312 | - | NZ_CP060111.1 | Klebsiella michiganensis |
| 16 | 3422009 | 3422071 | - | NZ_CP060111.1 | Klebsiella michiganensis |
| 17 | 1070045 | 1070095 | + | NZ_CP050508.1 | Raoultella terrigena |
| 18 | 2772256 | 2772324 | - | NZ_CP025799.1 | Dickeya zeae |
++ More..