Result : EXP00212
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00212 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 2878465 |
| Right | 2878503 |
| Strand | - |
| Nucleotide Sequence | ATGGGAAAAAATGCTTTAAGAACAAATGTATACTTTTAG |
| Sequence | MGKNALRTNVYF |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 12 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2878465 | 2878503 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 876271 | 876309 | + | NZ_CP061527.1 | Shigella dysenteriae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF12084.10 | 1.0 | 2 | 4852.5 | same-strand | Protein of unknown function (DUF3561) |
| 2 | PF01583.22 | 1.0 | 2 | 4197.5 | same-strand | Adenylylsulphate kinase |
| 3 | PF13671.8 | 1.0 | 2 | 4197.5 | same-strand | AAA domain |
| 4 | PF00009.29 | 1.0 | 2 | 2770.5 | same-strand | Elongation factor Tu GTP binding domain |
| 5 | PF03144.27 | 1.0 | 2 | 2770.5 | same-strand | Elongation factor Tu domain 2 |
| 6 | PF01507.21 | 1.0 | 2 | 1860.5 | same-strand | Phosphoadenosine phosphosulfate reductase family |
| 7 | PF04389.19 | 1.0 | 2 | 571.0 | opposite-strand | Peptidase family M28 |
| 8 | PF09707.12 | 1.0 | 2 | 66.0 | same-strand | CRISPR-associated protein (Cas Cas2CT1978) |
| 9 | PF08798.13 | 1.0 | 2 | 1285.0 | same-strand | CRISPR associated protein |
++ More..