Result : EXP00211
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00211 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 225728 |
| Right | 225772 |
| Strand | + |
| Nucleotide Sequence | ATGGATCGCAAGAAACATCTTCGGGTTGTGAGGTTAAGCGACTAA |
| Sequence | MDRKKHLRVVRLSD |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 14 |
++ More..
| Conservation Analysis |
No. of Species: 24
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2671241 | 2671285 | - | NZ_CP016337.1 | Kosakonia sacchari |
| 2 | 3169895 | 3169939 | + | NZ_CP016337.1 | Kosakonia sacchari |
| 3 | 3285756 | 3285800 | + | NZ_CP016337.1 | Kosakonia sacchari |
| 4 | 2146708 | 2146752 | - | NZ_CP016337.1 | Kosakonia sacchari |
| 5 | 3416028 | 3416072 | + | NZ_CP016337.1 | Kosakonia sacchari |
| 6 | 4343198 | 4343242 | + | NZ_CP016337.1 | Kosakonia sacchari |
| 7 | 3373652 | 3373696 | + | NZ_CP016337.1 | Kosakonia sacchari |
| 8 | 709891 | 709935 | + | NZ_CP015113.1 | Kosakonia radicincitans |
| 9 | 5476492 | 5476536 | + | NZ_CP015113.1 | Kosakonia radicincitans |
| 10 | 4848453 | 4848497 | - | NZ_CP015113.1 | Kosakonia radicincitans |
| 11 | 3824649 | 3824693 | - | NZ_CP015113.1 | Kosakonia radicincitans |
| 12 | 5363199 | 5363243 | + | NZ_CP015113.1 | Kosakonia radicincitans |
| 13 | 5568034 | 5568078 | + | NZ_CP015113.1 | Kosakonia radicincitans |
| 14 | 5608294 | 5608338 | + | NZ_CP015113.1 | Kosakonia radicincitans |
| 15 | 1341265 | 1341309 | + | NZ_CP014007.2 | Kosakonia oryzae |
| 16 | 5367069 | 5367113 | - | NZ_CP014007.2 | Kosakonia oryzae |
| 17 | 5157599 | 5157643 | - | NZ_CP014007.2 | Kosakonia oryzae |
| 18 | 5117320 | 5117364 | - | NZ_CP014007.2 | Kosakonia oryzae |
| 19 | 475747 | 475791 | + | NZ_CP014007.2 | Kosakonia oryzae |
| 20 | 4377735 | 4377779 | - | NZ_CP014007.2 | Kosakonia oryzae |
| 21 | 18753 | 18797 | + | NZ_CP009125.1 | Pectobacterium atrosepticum |
| 22 | 3856325 | 3856369 | - | NZ_CP009125.1 | Pectobacterium atrosepticum |
| 23 | 4381105 | 4381149 | - | NZ_CP009125.1 | Pectobacterium atrosepticum |
| 24 | 245521 | 245565 | + | NZ_CP009125.1 | Pectobacterium atrosepticum |
| 25 | 287660 | 287704 | + | NZ_CP009125.1 | Pectobacterium atrosepticum |
| 26 | 4650453 | 4650497 | - | NZ_CP009125.1 | Pectobacterium atrosepticum |
| 27 | 3680492 | 3680536 | - | NZ_CP009125.1 | Pectobacterium atrosepticum |
| 28 | 225728 | 225772 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 29 | 3943673 | 3943717 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 30 | 4037488 | 4037532 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 31 | 4168610 | 4168654 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 32 | 4210012 | 4210056 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 33 | 3125566 | 3125610 | - | NZ_CP045300.1 | Kosakonia arachidis |
| 34 | 2874512 | 2874556 | - | NZ_CP045300.1 | Kosakonia arachidis |
| 35 | 2168343 | 2168387 | - | NZ_CP045300.1 | Kosakonia arachidis |
| 36 | 2916918 | 2916962 | - | NZ_CP045300.1 | Kosakonia arachidis |
| 37 | 3583564 | 3583608 | + | NZ_CP045300.1 | Kosakonia arachidis |
| 38 | 4384536 | 4384580 | + | NZ_CP045300.1 | Kosakonia arachidis |
| 39 | 3003678 | 3003722 | - | NZ_CP045300.1 | Kosakonia arachidis |
| 40 | 4523455 | 4523499 | - | NZ_CP054058.1 | Scandinavium goeteborgense |
| 41 | 4427328 | 4427372 | - | NZ_CP054058.1 | Scandinavium goeteborgense |
| 42 | 4334567 | 4334611 | - | NZ_CP054058.1 | Scandinavium goeteborgense |
| 43 | 4295138 | 4295182 | - | NZ_CP054058.1 | Scandinavium goeteborgense |
| 44 | 414096 | 414140 | + | NZ_CP054058.1 | Scandinavium goeteborgense |
| 45 | 3705366 | 3705410 | - | NZ_CP054058.1 | Scandinavium goeteborgense |
| 46 | 1057745 | 1057789 | + | NZ_CP054058.1 | Scandinavium goeteborgense |
| 47 | 418219 | 418263 | + | NZ_CP011602.1 | Phytobacter ursingii |
| 48 | 4557386 | 4557430 | - | NZ_CP011602.1 | Phytobacter ursingii |
| 49 | 4416322 | 4416366 | - | NZ_CP011602.1 | Phytobacter ursingii |
| 50 | 4319117 | 4319161 | - | NZ_CP011602.1 | Phytobacter ursingii |
| 51 | 4273290 | 4273334 | - | NZ_CP011602.1 | Phytobacter ursingii |
| 52 | 3635009 | 3635053 | - | NZ_CP011602.1 | Phytobacter ursingii |
| 53 | 5164053 | 5164097 | + | NZ_CP011602.1 | Phytobacter ursingii |
| 54 | 229060 | 229104 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 55 | 4161902 | 4161946 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 56 | 3449500 | 3449544 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 57 | 4737242 | 4737286 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 58 | 4833738 | 4833782 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 59 | 4977919 | 4977963 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 60 | 5018945 | 5018989 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 61 | 5036023 | 5036067 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
| 62 | 1679342 | 1679386 | + | NZ_LT556085.1 | Citrobacter amalonaticus |
| 63 | 2449262 | 2449306 | + | NZ_LT556085.1 | Citrobacter amalonaticus |
| 64 | 1167137 | 1167181 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
| 65 | 1067769 | 1067813 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
| 66 | 865529 | 865573 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
| 67 | 822437 | 822481 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
| 68 | 2052591 | 2052635 | + | NZ_CP015750.1 | Pectobacterium wasabiae CFBP 3304 |
| 69 | 1402861 | 1402905 | - | NZ_CP015750.1 | Pectobacterium wasabiae CFBP 3304 |
| 70 | 1753728 | 1753772 | + | NZ_CP015750.1 | Pectobacterium wasabiae CFBP 3304 |
| 71 | 2884479 | 2884523 | + | NZ_CP015750.1 | Pectobacterium wasabiae CFBP 3304 |
| 72 | 1444403 | 1444447 | - | NZ_CP015750.1 | Pectobacterium wasabiae CFBP 3304 |
| 73 | 1112882 | 1112926 | - | NZ_CP015750.1 | Pectobacterium wasabiae CFBP 3304 |
| 74 | 567550 | 567594 | - | NZ_CP015750.1 | Pectobacterium wasabiae CFBP 3304 |
| 75 | 2718911 | 2718955 | + | NZ_CP033744.1 | Citrobacter freundii |
| 76 | 2976780 | 2976824 | + | NZ_CP033744.1 | Citrobacter freundii |
| 77 | 2278817 | 2278861 | - | NZ_CP044098.1 | Citrobacter portucalensis |
| 78 | 2136823 | 2136867 | - | NZ_CP044098.1 | Citrobacter portucalensis |
| 79 | 2371335 | 2371379 | - | NZ_CP044098.1 | Citrobacter portucalensis |
| 80 | 2854155 | 2854199 | + | NZ_CP044098.1 | Citrobacter portucalensis |
| 81 | 1938856 | 1938900 | - | NZ_CP044098.1 | Citrobacter portucalensis |
| 82 | 1375522 | 1375566 | - | NZ_CP044098.1 | Citrobacter portucalensis |
| 83 | 3687584 | 3687628 | + | NZ_CP044098.1 | Citrobacter portucalensis |
| 84 | 291204 | 291248 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 85 | 3570066 | 3570110 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 86 | 2799754 | 2799798 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 87 | 4102010 | 4102054 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 88 | 4198098 | 4198142 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 89 | 4353169 | 4353213 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 90 | 4396593 | 4396637 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 91 | 687 | 731 | + | NZ_CP017279.1 | Enterobacter ludwigii |
| 92 | 3187368 | 3187412 | - | NZ_CP017279.1 | Enterobacter ludwigii |
| 93 | 3077608 | 3077652 | - | NZ_CP017279.1 | Enterobacter ludwigii |
| 94 | 2833048 | 2833092 | - | NZ_CP017279.1 | Enterobacter ludwigii |
| 95 | 3472233 | 3472277 | + | NZ_CP017279.1 | Enterobacter ludwigii |
| 96 | 4021320 | 4021364 | + | NZ_CP017279.1 | Enterobacter ludwigii |
| 97 | 4131855 | 4131899 | + | NZ_CP017279.1 | Enterobacter ludwigii |
| 98 | 4748682 | 4748726 | - | NC_015968.1 | Enterobacter soli |
| 99 | 4623724 | 4623768 | - | NC_015968.1 | Enterobacter soli |
| 100 | 259087 | 259131 | + | NC_015968.1 | Enterobacter soli |
| 101 | 4530683 | 4530727 | - | NC_015968.1 | Enterobacter soli |
| 102 | 4284949 | 4284993 | - | NC_015968.1 | Enterobacter soli |
| 103 | 867057 | 867101 | + | NC_015968.1 | Enterobacter soli |
| 104 | 3542195 | 3542239 | - | NC_015968.1 | Enterobacter soli |
| 105 | 4719528 | 4719572 | - | NZ_CP038498.1 | Pectobacterium punjabense |
| 106 | 202362 | 202406 | + | NZ_CP038498.1 | Pectobacterium punjabense |
| 107 | 254973 | 255017 | + | NZ_CP038498.1 | Pectobacterium punjabense |
| 108 | 3666233 | 3666277 | - | NZ_CP038498.1 | Pectobacterium punjabense |
| 109 | 3538535 | 3538579 | - | NZ_CP038498.1 | Pectobacterium punjabense |
| 110 | 296976 | 297020 | + | NZ_CP038498.1 | Pectobacterium punjabense |
| 111 | 4211188 | 4211232 | - | NZ_CP038498.1 | Pectobacterium punjabense |
| 112 | 110376 | 110420 | + | NZ_CP012871.1 | [Enterobacter] lignolyticus |
| 113 | 208192 | 208236 | + | NZ_CP012871.1 | [Enterobacter] lignolyticus |
| 114 | 252861 | 252905 | + | NZ_CP012871.1 | [Enterobacter] lignolyticus |
| 115 | 4154496 | 4154540 | - | NZ_CP012871.1 | [Enterobacter] lignolyticus |
| 116 | 940960 | 941004 | + | NZ_CP012871.1 | [Enterobacter] lignolyticus |
| 117 | 3487614 | 3487658 | - | NZ_CP012871.1 | [Enterobacter] lignolyticus |
| 118 | 4672737 | 4672781 | + | NZ_CP012871.1 | [Enterobacter] lignolyticus |
| 119 | 227466 | 227510 | + | NZ_AP014857.1 | Escherichia albertii |
| 120 | 3402769 | 3402813 | - | NZ_AP014857.1 | Escherichia albertii |
| 121 | 2698358 | 2698402 | - | NZ_AP014857.1 | Escherichia albertii |
| 122 | 3910564 | 3910608 | + | NZ_AP014857.1 | Escherichia albertii |
| 123 | 4007970 | 4008014 | + | NZ_AP014857.1 | Escherichia albertii |
| 124 | 4141117 | 4141161 | + | NZ_AP014857.1 | Escherichia albertii |
| 125 | 4181459 | 4181503 | + | NZ_AP014857.1 | Escherichia albertii |
| 126 | 372481 | 372525 | + | NZ_AP022508.1 | Enterobacter bugandensis |
| 127 | 897501 | 897545 | + | NZ_AP022508.1 | Enterobacter bugandensis |
| 128 | 4177572 | 4177616 | - | NZ_AP022508.1 | Enterobacter bugandensis |
| 129 | 2830528 | 2830572 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 130 | 2716973 | 2717017 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 131 | 2348053 | 2348097 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 132 | 3111640 | 3111684 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 133 | 3152103 | 3152147 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 134 | 3780926 | 3780970 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 135 | 4043900 | 4043944 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 136 | 4256 | 4300 | + | NZ_CP017280.1 | Enterobacter ludwigii |
| 137 | 91084 | 91128 | + | NZ_CP017280.1 | Enterobacter ludwigii |
| 138 | 216625 | 216669 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 139 | 216983 | 217027 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 140 | 3409646 | 3409690 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 141 | 2726213 | 2726257 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 142 | 3953155 | 3953199 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 143 | 4050346 | 4050390 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 144 | 4188535 | 4188579 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 145 | 4228973 | 4229017 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 146 | 3751869 | 3751913 | + | NZ_CP045769.1 | Enterobacter cancerogenus |
| 147 | 4076370 | 4076414 | + | NZ_CP045769.1 | Enterobacter cancerogenus |
| 148 | 4400595 | 4400639 | - | NZ_LR134340.1 | Escherichia marmotae |
| 149 | 4297664 | 4297708 | - | NZ_LR134340.1 | Escherichia marmotae |
| 150 | 208790 | 208834 | + | NZ_LR134340.1 | Escherichia marmotae |
| 151 | 248986 | 249030 | + | NZ_LR134340.1 | Escherichia marmotae |
| 152 | 3929941 | 3929985 | - | NZ_LR134340.1 | Escherichia marmotae |
| 153 | 848493 | 848537 | + | NZ_LR134340.1 | Escherichia marmotae |
| 154 | 3248077 | 3248121 | - | NZ_LR134340.1 | Escherichia marmotae |
| 155 | 1848999 | 1849043 | + | NZ_CP047495.1 | Pectobacterium brasiliense |
| 156 | 1890947 | 1890991 | + | NZ_CP047495.1 | Pectobacterium brasiliense |
| 157 | 2160690 | 2160734 | + | NZ_CP047495.1 | Pectobacterium brasiliense |
| 158 | 2677787 | 2677831 | + | NZ_CP047495.1 | Pectobacterium brasiliense |
| 159 | 2822432 | 2822476 | + | NZ_CP047495.1 | Pectobacterium brasiliense |
| 160 | 1551067 | 1551111 | - | NZ_CP047495.1 | Pectobacterium brasiliense |
| 161 | 1322519 | 1322563 | - | NZ_CP047495.1 | Pectobacterium brasiliense |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP015750.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00497.22 | 0.83 | 20 | 6572.0 | opposite-strand | Bacterial extracellular solute-binding proteins, family 3 |
| 2 | PF00528.24 | 0.96 | 23 | 4206 | opposite-strand | Binding-protein-dependent transport system inner membrane component |
| 3 | PF00005.29 | 0.96 | 23 | 3408 | opposite-strand | ABC transporter |
| 4 | PF00132.26 | 0.96 | 23 | 2426 | opposite-strand | Bacterial transferase hexapeptide (six repeats) |
| 5 | PF07369.13 | 0.96 | 23 | 2956 | same-strand | Protein of unknown function (DUF1488) |
| 6 | PF08501.13 | 0.96 | 23 | 3210 | same-strand | Shikimate dehydrogenase substrate binding domain |
| 7 | PF18317.3 | 0.96 | 23 | 3210 | same-strand | Shikimate 5'-dehydrogenase C-terminal domain |
| 8 | PF01300.20 | 0.92 | 22 | 4011.0 | same-strand | Telomere recombination |
| 9 | PF00294.26 | 0.88 | 21 | 5450.0 | same-strand | pfkB family carbohydrate kinase |
| 10 | PF13377.8 | 0.92 | 22 | 4456 | same-strand | Periplasmic binding protein-like domain |
| 11 | PF00532.23 | 0.92 | 22 | 4454 | same-strand | Periplasmic binding proteins and sugar binding domain of LacI family |
| 12 | PF00356.23 | 0.92 | 22 | 4454 | same-strand | Bacterial regulatory proteins, lacI family |
| 13 | PF13407.8 | 0.92 | 22 | 4454 | same-strand | Periplasmic binding protein domain |
| 14 | PF07690.18 | 0.96 | 23 | 3428 | same-strand | Major Facilitator Superfamily |
| 15 | PF00392.23 | 0.75 | 18 | 2347 | opposite-strand | Bacterial regulatory proteins, gntR family |
| 16 | PF07729.14 | 0.75 | 18 | 2347 | opposite-strand | FCD domain |
| 17 | PF03205.16 | 0.88 | 21 | 3206.0 | opposite-strand | Molybdopterin guanine dinucleotide synthesis protein B |
| 18 | PF12804.9 | 0.88 | 21 | 3714.0 | opposite-strand | MobA-like NTP transferase domain |
| 19 | PF06288.15 | 0.88 | 21 | 4368.0 | same-strand | Protein of unknown function (DUF1040) |
| 20 | PF01636.25 | 0.88 | 21 | 4714.0 | same-strand | Phosphotransferase enzyme family |
| 21 | PF05958.13 | 0.88 | 21 | 5349.0 | opposite-strand | tRNA (Uracil-5-)-methyltransferase |
| 22 | PF00593.26 | 0.88 | 21 | 3138.5 | same-strand | TonB dependent receptor |
| 23 | PF07715.17 | 0.88 | 21 | 3138.5 | same-strand | TonB-dependent Receptor Plug Domain |
| 24 | PF01177.24 | 0.88 | 21 | 2335.5 | same-strand | Asp/Glu/Hydantoin racemase |
| 25 | PF00126.29 | 0.96 | 23 | 4194.0 | opposite-strand | Bacterial regulatory helix-turn-helix protein, lysR family |
| 26 | PF03466.22 | 0.96 | 23 | 4195 | opposite-strand | LysR substrate binding domain |
| 27 | PF04219.14 | 0.71 | 17 | 4374.0 | same-strand | Protein of unknown function, DUF |
| 28 | PF01078.23 | 0.71 | 17 | 4745.5 | opposite-strand | Magnesium chelatase, subunit ChlI |
| 29 | PF13541.8 | 0.67 | 16 | 4739 | opposite-strand | Subunit ChlI of Mg-chelatase |
| 30 | PF13335.8 | 0.71 | 17 | 4737.5 | opposite-strand | Magnesium chelatase, subunit ChlI C-terminal |
| 31 | PF07728.16 | 0.92 | 22 | 4733 | same-strand | AAA domain (dynein-related subfamily) |
| 32 | PF02776.20 | 0.67 | 16 | 6845 | same-strand | Thiamine pyrophosphate enzyme, N-terminal TPP binding domain |
| 33 | PF02775.23 | 0.67 | 16 | 6846 | same-strand | Thiamine pyrophosphate enzyme, C-terminal TPP binding domain |
| 34 | PF00205.24 | 0.67 | 16 | 6845 | same-strand | Thiamine pyrophosphate enzyme, central domain |
| 35 | PF00248.23 | 0.71 | 17 | 3401 | same-strand | Aldo/keto reductase family |
| 36 | PF13242.8 | 0.88 | 21 | 2324 | same-strand | HAD-hyrolase-like |
| 37 | PF09383.12 | 0.92 | 22 | 3083 | opposite-strand | NIL domain |
| 38 | PF02463.21 | 0.92 | 22 | 3084.0 | opposite-strand | RecF/RecN/SMC N terminal domain |
| 39 | PF13401.8 | 0.92 | 22 | 3083 | opposite-strand | AAA domain |
| 40 | PF03180.16 | 0.92 | 22 | 4801.0 | opposite-strand | NlpA lipoprotein |
| 41 | PF01071.21 | 0.88 | 21 | 4082.5 | opposite-strand | Phosphoribosylglycinamide synthetase, ATP-grasp (A) domain |
| 42 | PF02844.17 | 0.88 | 21 | 4082.5 | opposite-strand | Phosphoribosylglycinamide synthetase, N domain |
| 43 | PF02843.18 | 0.88 | 21 | 4082.5 | opposite-strand | Phosphoribosylglycinamide synthetase, C domain |
| 44 | PF02655.16 | 0.88 | 21 | 4082.5 | opposite-strand | ATP-grasp domain |
| 45 | PF01808.20 | 0.88 | 21 | 2474.5 | opposite-strand | AICARFT/IMPCHase bienzyme |
| 46 | PF02142.24 | 0.88 | 21 | 2474.5 | opposite-strand | MGS-like domain |
| 47 | PF04204.18 | 0.83 | 20 | 3793 | same-strand | Homoserine O-succinyltransferase |
| 48 | PF01274.24 | 0.83 | 20 | 4992 | same-strand | Malate synthase |
| 49 | PF06315.13 | 0.75 | 18 | 7968.5 | same-strand | Isocitrate dehydrogenase kinase/phosphatase (AceK) |
| 50 | PF13525.8 | 0.79 | 19 | 6881 | opposite-strand | Outer membrane lipoprotein |
| 51 | PF13512.8 | 0.79 | 19 | 6881 | opposite-strand | Tetratricopeptide repeat |
| 52 | PF00849.24 | 0.83 | 20 | 5765.0 | same-strand | RNA pseudouridylate synthase |
| 53 | PF01479.27 | 0.83 | 20 | 5765.0 | same-strand | S4 domain |
| 54 | PF02578.17 | 0.83 | 20 | 5037.0 | same-strand | Multi-copper polyphenol oxidoreductase laccase |
| 55 | PF07724.16 | 0.79 | 19 | 2338 | same-strand | AAA domain (Cdc48 subfamily) |
| 56 | PF17871.3 | 0.79 | 19 | 2338 | same-strand | AAA lid domain |
| 57 | PF02861.22 | 0.79 | 19 | 2338 | same-strand | Clp amino terminal domain, pathogenicity island component |
| 58 | PF10431.11 | 0.79 | 19 | 2338 | same-strand | C-terminal, D2-small domain, of ClpB protein |
| 59 | PF00004.31 | 0.88 | 21 | 2441 | same-strand | ATPase family associated with various cellular activities (AAA) |
| 60 | PF10043.11 | 0.83 | 20 | 4742.0 | opposite-strand | Predicted periplasmic lipoprotein (DUF2279) |
| 61 | PF13091.8 | 0.88 | 21 | 5098 | opposite-strand | PLD-like domain |
| 62 | PF00614.24 | 0.88 | 21 | 5098 | opposite-strand | Phospholipase D Active site motif |
| 63 | PF13549.8 | 0.88 | 21 | 6591 | opposite-strand | ATP-grasp domain |
| 64 | PF13607.8 | 0.88 | 21 | 6591 | opposite-strand | Succinyl-CoA ligase like flavodoxin domain |
| 65 | PF13380.8 | 0.88 | 21 | 6591 | opposite-strand | CoA binding domain |
| 66 | PF13302.9 | 0.88 | 21 | 6591 | opposite-strand | Acetyltransferase (GNAT) domain |
| 67 | PF00583.27 | 0.88 | 21 | 6540.5 | opposite-strand | Acetyltransferase (GNAT) family |
| 68 | PF00557.26 | 0.79 | 19 | 5010.5 | same-strand | Metallopeptidase family M24 |
| 69 | PF01205.21 | 0.88 | 21 | 4395.5 | same-strand | Uncharacterized protein family UPF0029 |
| 70 | PF09186.13 | 0.88 | 21 | 4395.5 | same-strand | Domain of unknown function (DUF1949) |
| 71 | PF02386.18 | 0.88 | 21 | 2903.5 | same-strand | Cation transport protein |
| 72 | PF12724.9 | 0.88 | 21 | 2347.5 | same-strand | Flavodoxin domain |
| 73 | PF02873.18 | 0.88 | 21 | 3259 | same-strand | UDP-N-acetylenolpyruvoylglucosamine reductase, C-terminal domain |
| 74 | PF01565.25 | 0.88 | 21 | 3259 | same-strand | FAD binding domain |
| 75 | PF03099.21 | 0.88 | 21 | 4314.0 | same-strand | Biotin/lipoate A/B protein ligase family |
| 76 | PF08279.14 | 0.88 | 21 | 4314.0 | same-strand | HTH domain |
| 77 | PF02237.19 | 0.88 | 21 | 4314.0 | same-strand | Biotin protein ligase C terminal domain |
| 78 | PF14602.8 | 0.71 | 17 | 2379 | opposite-strand | Hexapeptide repeat of succinyl-transferase |
| 79 | PF03942.17 | 0.75 | 18 | 9257.5 | opposite-strand | DTW domain |
| 80 | PF01323.22 | 0.79 | 19 | 5716.5 | same-strand | DSBA-like thioredoxin domain |
| 81 | PF13462.8 | 0.79 | 19 | 5716.5 | same-strand | Thioredoxin |
| 82 | PF00009.29 | 0.67 | 16 | 7293 | same-strand | Elongation factor Tu GTP binding domain |
| 83 | PF03143.19 | 0.67 | 16 | 7293 | same-strand | Elongation factor Tu C-terminal domain |
| 84 | PF03144.27 | 0.67 | 16 | 7293 | same-strand | Elongation factor Tu domain 2 |
| 85 | PF01926.25 | 0.75 | 18 | 7293 | same-strand | 50S ribosome-binding GTPase |
| 86 | PF07226.13 | 0.75 | 18 | 6502 | same-strand | Protein of unknown function (DUF1422) |
| 87 | PF00158.28 | 0.62 | 15 | 5339.5 | same-strand | Sigma-54 interaction domain |
++ More..