Result : EXP00206
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00206 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 3423130 |
| Right | 3423186 |
| Strand | + |
| Nucleotide Sequence | ATGAATTTTTTGCGCATCCTAAATCAGAGCGTACGAGGGCATTTTTATCGCAGGTAA |
| Sequence | MNFLRILNQSVRGHFYRR |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 18 |
++ More..
| Conservation Analysis |
No. of Species: 7
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3423130 | 3423186 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 3406173 | 3406229 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 3 | 2344406 | 2344462 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 4 | 4158263 | 4158319 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 5 | 401728 | 401784 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 6 | 5444983 | 5445039 | + | NZ_CP045205.1 | Citrobacter telavivensis |
| 7 | 4174074 | 4174130 | + | NZ_AP022508.1 | Enterobacter bugandensis |
| 8 | 1999913 | 1999969 | + | NZ_AP019007.1 | Enterobacter oligotrophicus |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00528.24 | 1.0 | 7 | 702 | same-strand | Binding-protein-dependent transport system inner membrane component |
| 2 | PF00005.29 | 1.0 | 7 | -56.0 | same-strand | ABC transporter |
| 3 | PF00132.26 | 0.86 | 6 | 5879 | same-strand | Bacterial transferase hexapeptide (six repeats) |
| 4 | PF14602.8 | 0.71 | 5 | 5849.5 | same-strand | Hexapeptide repeat of succinyl-transferase |
| 5 | PF07369.13 | 0.86 | 6 | 6409 | opposite-strand | Protein of unknown function (DUF1488) |
| 6 | PF08501.13 | 0.86 | 6 | 6663 | opposite-strand | Shikimate dehydrogenase substrate binding domain |
| 7 | PF18317.3 | 0.86 | 6 | 6663 | opposite-strand | Shikimate 5'-dehydrogenase C-terminal domain |
| 8 | PF00497.22 | 0.86 | 6 | 3064.0 | same-strand | Bacterial extracellular solute-binding proteins, family 3 |
++ More..