Result : EXP00205
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00205 |
| NCBI Accession ID | NC_000913.3 |
| Organism | Escherichia coli str. K-12 substr. MG1655 |
| Left | 8085 |
| Right | 8141 |
| Strand | + |
| Nucleotide Sequence | ATGGCGGGCGATATCAACGCAGTGTCAGAAATCCGAAACAGTCTCGCCTGGCGATAA |
| Sequence | MAGDINAVSEIRNSLAWR |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 27013550 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 18 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 8102 | 8158 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 8085 | 8141 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 3606538 | 3606594 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 4 | 8084 | 8140 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 5 | 635181 | 635237 | + | NZ_LR134340.1 | Escherichia marmotae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00291.27 | 1.0 | 4 | 3065 | same-strand | Pyridoxal-phosphate dependent enzyme |
| 2 | PF14821.8 | 1.0 | 4 | 3065 | same-strand | Threonine synthase N terminus |
| 3 | PF03883.16 | 1.0 | 4 | 1626 | opposite-strand | Peroxide stress protein YaaA |
| 4 | PF01235.19 | 0.75 | 3 | 126.0 | opposite-strand | Sodium:alanine symporter family |
| 5 | PF00923.21 | 1.0 | 4 | 97 | same-strand | Transaldolase/Fructose-6-phosphate aldolase |
| 6 | PF00994.26 | 1.0 | 4 | 1165 | same-strand | Probable molybdopterin binding domain |
| 7 | PF01184.21 | 1.0 | 4 | 1787 | opposite-strand | GPR1/FUN34/yaaH family |
| 8 | PF03981.14 | 0.75 | 3 | 2502.0 | opposite-strand | Ubiquinol-cytochrome C chaperone |
| 9 | PF13099.8 | 0.75 | 3 | 2502.0 | opposite-strand | Domain of unknown function (DUF3944) |
| 10 | PF10807.10 | 0.75 | 3 | 3241.0 | opposite-strand | Protein of unknown function (DUF2541) |
++ More..